Description :
From Genome Similarity Track
Location :
Scaffold_3279:94- 2590
Sequence
2496 bases(100 bases per row)
GAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGGAAGCCGTTCAAGTAGAACGGCGTAAACCCCTTGGACGCGTGCACCGCG
TTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGCCGACCACGTACGTGGTGCTGCTGCGCACACACTGCGCAGAGTGTCCTCGAGCTCTCGATTGACGC
GCTCTGTTTGGCCGTCGGTCTGCGGATGGTCCGCAGTGGACTTCTGCAGACAAGTTCCCAGTAAAGGAAACAGCGCTATCCAAAACGCGGCAGTGAACCG
CGGGTCTCGGTCCGAGACAATCTCCGGGAGACCGTGATAGCGGAACACTCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGTTACAGTGACGGGAACT
GAAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGCAAGCCCAAAGATGAAGTCAAGACTCA
TCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTGACGTA
CCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGCACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCTGCTGGAGGGCGCGTCATGC
GCCTCCGCGAGGATGTCGAACTTCAGATCCTCGTCGTTGGGTACGACCACCCGTGGAGGATCAGTGGGCTCCACCCGATAATAGAGGAGGCCCTCCTTCA
ACTCATATCGGTGGAGCCATGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTC
ATCGTCCCGATACGCCATGCGTATCCGATCATATAGATCCGCTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCGAGAGAGAGCGTCCGCA
AGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTATTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTAG
TCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACAAAGGCCCTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAG
CTCCTTGTCATGGTCAGGGTAGTTCCGCTCGGCGGCTTTGAGCTGCCGGGACTGGAACGAGATGACTCGTTCGTGTCCAGCCGTGTCGGCCTGCAGCAAT
GCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCCTCCCGGCAGGGCCAGGACAGGGGCCCTCTTGGAGACTGGCCTT
GATGCTGTCAAAAGCGTCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGACTCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCG
CTGTACTTGTAAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGG
TCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTC
GCATTACGTCCAACACTCGACGGAGGTGACCTAGATGCACCTCCATAGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGT
CTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAGGCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAA
AGCATGTCGCTTGGAGTGCTCACCGCGGTGAGCGGGATGTCGCCCTCTCGCATCAGGATCTGGTAGTATCCGTCTCCAGCGCACTGTACCGTACGCTTCC
GGCATGTTGTTTAACAACACATCCTTTCGTGGGATTGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGGATGAACTAGACGCCTCTTTC
CGTTCGGCTTCCGAACGCAGAAAGTTGGCGTCGAGTGCGGGGATTTCGACTACCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGAC
CTCGCACTGTTCGCGCGGGAGAAGCCATTGCCTCGTGACACAATACTTTGTGCCAGGCACGAGATCAATCTCATGCCGTACACCTCGATCCGGTGGGAGT
TGGGTCGGCGGGTGTTTGTTCACCACGTCCGCATACTCCGTCACCAAAAGATACACCGGATCCTTGGGGTTCTTTAGGATCTCAGAACCCAGGCGCGTCT
GACGCTGTTTGTTTAGGTCTTCCAGGACGTTCTCGTCCAGACAGAGGAGGCGTTCAGCTCCTCCCGAGTGGTCTCAGGTCTCATGAACACCATCTC