Description :
From Genome Similarity Track
Location :
Scaffold_2479:94- 2344
Sequence
2250 bases(100 bases per row)
GAGGGTCAACGAGGATCGGGACGGATTGATGAGACTGGTGATGCCACAAACCTTACAACAGGATGTCCTACATCACTATCACGTTAGTTTAGAAGGCGGA
CATCAGGGGATTGGTCGGACCTACCAACGGATCCGTGAATGATTCCACTGGAGGGGACTATTCAAGAGTGTGCAACGATATGTCGGTGAGTGTGTGGATT
GTGAGACAGGTAAGGGCAGGCCCACAATCGAAGGGGAGGCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTC
GTTACTCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGGTAGCCAAAGCTAGTGCGTCTAGAACTGCACAA
ACCATTGCCGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGGGCTAGTGAGATGATTAGACATGATCGGGAGCCAGGCTTTACGTCCGACCTCTTTC
GAGCCTTCAACCGCCTCACCGTCAATGAAGCGGAGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACAAGATCCAAAATGGCTATTGATTTG
TGGAGATTCAAACTTGGTGATCAGACAGGTGCGAGGTGAGATTGACGGCAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGT
GGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGTGCCGCTTTACGGAATCAATGAGGTGTCGAGG
TGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTAAACCGACTAGACGAAGTGGTGGTGGTTGGATCCGGGAAAAGGACAGTCCAGGTGATGGCGGT
CACTAGATTCAGAGGGAGGATTGGATCCAGCCCCCAGGTTCTCGGTGAAACATTTGTGAAAGGAGTCCGCATTGAGCGGATCCTCCAAGCACAGAACGAA
GAAGCGTGGATCTTGGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACGAAATCCTACAGTATTATCGCTACGGATTATG
CAGTGGATCTGAATGACTTGCTCTTCTATTGTCCCCCTACGAAGAGGGTCAACGAGGATCGGGACGGATTGATGAGACTGGTGATGCCACAAACCTTACA
ACAGGATGTCCTACATCACTATCACGCTAGTTTAGAAGGTGGACATCAGGGAATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCACTGGAGGGGA
CTATTCAAGAGTGTGCAACGATATGTCGGTGAGTGTGTGGATTGTGAGACAGGTAAGGGCAGGCCCACAATCGAAGGGGAGGCACCTGGGAATGTCCAAG
CGACTTACCCTTTCCAAATCATAGCCATGGATCACATCCCCTCGTTACTCAAGTCGTTCAAAGGAAACACAGAATTGTTGATCGGGGTGGATCTGTCTAC
CGGATACGTGATAGCCAAAGCTAGCGCGTCTAGAACTGCACAAATCATCGCCGAATCGTACGAGGAGTGCGTTTTTCGAAGATTTGGAGCTACTGAGATG
GCTCGGCATGATCGGGAGCCAGACTTTATGTCTGATTTCTTTCGAGCCTTCAACCGGGTCCTGGGGCAGAGACAGCGGGCGACTATGGCATATCGTCCCC
AAGCCAATGGATCAGCCGAACGCATGGTACAGACGATCACGAGGGCGTTCAAGATGTATGTTCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGA
ACGACTCCCCTTCGCGATGAACACCGCCCAAGACAGGATGCGGGGTGACACCCCATTTTACTTGGTACATGGGTGGGATCCTAAATCTACTTTAGAAGCG
ACCATTCCGGTGTGTAGCACCAAGAAGAGGAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAAGTGAACG
AACGGCTACGAAGTCCGATACAGGATCGAGCGGATCGACACAACGAAGACGCTCGTCCACATCAAATCCAAGTGGGATCGCAGGTGTGGCTTTATTTAGA
TCGGGTGAAGGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCGAAAAGATAGAGGAACATGCGGTGAACTTGGAAACG
GCAAGTACCGAATATCACTTGTTCCCTGTAGTACACGTATCCAAGCTGAA