Description :
From Genome Similarity Track
Location :
Scaffold_764:94- 2018
Sequence
1924 bases(100 bases per row)
TTGTTTAATCACATAGACGATTTCATCTGACGATTCTCCATCCGTTGACACGCACGGAGAGTTTCTTCCATCTCATTAATATCCATCAATCGCAGTAAGG
TCAGCTGTTTTGCCAGATCGCGATCGTCCAGCGTAGCATGAAGTGTTCCACATGCTCGCGACTCGTGGCCGATGTAGCCAGTCTTTCTTCTTTAATCGCC
ATCTTGGCATGCTTGGCCGCGACATTAAGACGATGCAAGTACTCCGGCGGGATTTTATCGGATCGCTTCCGTGCGAGGTAATACTGTCTGGCTACTAACA
CACCTTGCCCTCCATACTGTATCATAAAACAATCCAGCAATCGTTTCCACTTGTGCTGTGTAGATCGGCTCAGTTGGTTGTACCAGTTTCGCACGGGTCC
CGTCAACAGATCACCGAACACCGAACACCAAACACTTTTCTTCATCTGGCGCCTGATCACGCAGGAACGCCGACTTGACCTTGCTGATCCAAATTCTGGC
CCGATCTACGTCTCGATCTTTGCCACTGGATTCCTTCAGCTCCGTCATCGCTGACACTCGAATGCGTTGGGGAATACCACCACCGTTTTGCAACGTCTCT
GTGGTGGCTACCATCGCACGTCACCGATTTTCTTGTCCCGAATCATTGGGATCGGCATCTTTGGGATCGAAAATGTCAGATCGACTGTGAGGCGATCGCA
CCGACTCCATCTCAACATCTGGGGTATATGTTTCTTGGACTCTTGCCGGCTTGATTATTTGGCTTGGGTAGATCGCTTGATACGCTCGTTCCCGTTGATC
TTGATGAAAACGTTCTATGTCCTCATCGAGGTACGTCCGCAGGTGTCCTTGCATAGTTGACGTCATCTCTCCTTTAGCGCATGTGATCGTCGATTGCGGT
TCGATCTTGATCGTCTCAACTCGATCGCGTAGATGTGCTACCCCACTTGGGCCTAGAGACATCCGCTGAATACCGACCAAATCATCCGAATCCATTTCAG
AATCAGCCGAGGCGTACTGCGACGATCCGGTATGGTATCCTCTCAGGAAGTCGGCGATCGTAGTGGCACCTTGATCTGTGGATTCGCACTTACCCGTCAG
GGGGTTCAACTTGTTATATAGCGATCGACACGCGTGGATCACCTGGTCTTGATCGCACTCCAGCATTTTATTCGCGTCGAATACTCCAGCAACGTATCCA
GCGTCATGTAGTAGCTGGATGATCGCATTGATCCCGTCCAGTGGGTTAGTTGTCACTGTCGGTGGAGATATCGTACCTTGAATCTCTACGATCTGCTTGG
GCTTCAATATCTGGAGCACTGGATTGCTCAATAGCAGATTCTTAAGCGCCTTCCAGTGATATCCCTGCGCCAATCGGTCCAACTGCCAGCCATCCATCTT
CATGTTATCGTCCACAAACGTCGGTCGATTGATCGATTTCACACTGCGATCGTGTTGATCCGATCTGGGCTCTTCTTTCTTCATTCGATCTGTCTTCTTC
GACATTGCCTGAGTGGTCTTGTGTAGTTTTTGTTCAGTTTTCGCTGAAGCGTTTTCACCCAGCGGATCGTGCTTTGCAGCACGATCCGTGGTGGTCCCCG
AATGGACCTCAGGAGGGGGTCGAGGTTTCTCTTCCAGTTCAATTGATCGATCTTTCTCTTTGATCTTCTTGTCATCAGAGCCCCTTTCTCAAACTCTGAA
GATCTGAGGATCTTTTAAAACCACGCATCTGCGGTGATCCCTCTGCCTCATACACTTCCATTCCAGGTTCAACCTTGACCTTCTCATCTTCACTCAGGGA
CTCACGGTGAAGTCTTGAGTCACCAGAAGATCCGGGCACGCGCACCATTGTGGTGGAGTGGCGATAGCTTATTTTATGAGGCGATTTTAACTCTCCACTG
GTGCCCAGACGACCGACTATCGGA