Description :
From Genome Similarity Track
Location :
Scaffold_1708:94- 1525
Sequence
1431 bases(100 bases per row)
GCTTGTGTTCGATCAGAGCTCTATGGCGTACTGGATCCCGAGCCTTCATTCTCTGGGTCTTCCTGTCCTCGGATCCTCGACCGCGCTTCCAGCATGGATA
CCCCGGAGGATCGTATGGTCTAGAATCGTGGTTCGGACGACGTGTCTGACCCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCT
CGGTGACGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCT
AGCTCGAAGATATCCTCTGCGTCGAACACCCCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTT
TCGTTGGTGCTCTCACCGGTTCCCTTGGATCGTCGATCTGTCGTGGATTCAGAATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTG
GCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTA
CTCGTTCTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAATCGGTGAATCTGCAAATGCATACTGTTTCGCCT
TCACTTTCCCTTGTTTTGTTAGCGGATCCCCGAGGGGACCTGGGGAGGATAGAGAGGTCTCTCTTCTAGATCCGGATCCGGATCTACCTCTCTTCCATCG
ACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAA
TCTTCACTTGAGCATCTTCTTGGGACTCACGGTAAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGCGTAGCGGGATCAGCAAAATCT
GCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTTACCTTGTG
TACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCA
GCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAG
GGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGTATCTTGAGAGTTGAGATCCTCTAGGGTG
TAACCGACCAAGTAGTAAATTCGGTTAACCT