Description :
From Genome Similarity Track
Location :
Scaffold_212:93985- 97642
Sequence
3657 bases(100 bases per row)
GACCCGTTACACCTGGTAGCACTTCGTAGTCCGTCCAAGGACCACAAACCCGTTCAACATGAACATGTTGGACGACGAGGCGACGACACCTTTCACGGCA
CCCGGAAAAGTCACTCCTATTTGAGCGATGTCGAATGGATTGCGGTCGGACGAATGAGCTCGACCGTTAGCGAAGAAGCTGTCTGGTCTCTGCTATCATC
AATGGATACGGGCCAACAGCATTCCATCATCGCCAAGTTCTTGCAGCGAGAACTTGACGCGTCGCGAGCTGAAGTGACCCTGATGCATCAGCATGGTCAC
CTGCAGACTGAGCTCCTGAGACAGCAACAGTCTTAGTCTGCTACTGCAGCGTCGACACGTGAGCGTCGACGCGAGACTCTAAAGTTAGAAGTCTCCAAGT
ACCGGGGAGTCGAGGAAGACTCCTTGTTGAGATGGCTGCTAGAAGTGGACGATTCCATTAAGGCTCCCCATATTGACAATGAAGAATTGCAGGTTGCATT
TGCCGAATCGAATTTGGCAGGGCGTGCCAGAACTTGGGCCCTGAATCTTCAATTACACGATCCAAACGTGTTTGAATCGTTGGCGGTCTTTAAGACTCTG
CTCAATCAAACTATTGAGCCGCCAAGAGCTGAGTTCAGTATTCTTTCAGAGCTCCTGAAGATAAAACAAGGTAAGCGTGACGTTCACGCTTACGCTCAGC
ACGTTCGTTACCTTGCAAGTTGCATGGTAGCGAATCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTCATTAGATGCTACCATGCAAC
TTGCAAGGTAACGAACGTGCTGAGCGAGACGTCAATATATCGTGACTTGTTAGCACTGACAACTAAAAGATTTCCTTTCGCGCGGTGAGCGCTGCATTAT
GATACTGACATGGGATCTTCAACCTCATCCAAGTATCAAAAGAGCAAAATATTGAGGTCGAAACAACTTTTCACTTCTCGATGGCTGACTAACTCCACAC
ACAATAGGAGACGTGGTCGACACTGCCTACTGAAGACTACTCTCTGGGTTGCTGCAACTGAACTAAAATATGCCTCTCCCGAGAGGGACTGTCGTCCTGC
TTAACCCAATATGCACCTCCTGTCTGAGAGTGTCAGATAGACATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTCAATCTTGGGAGTCGCCTTAGGAAAATCCTTTGTATA
AGGATTTGATCGAATTCAAGGACGTGTTCCTGAGTCCGTACCATGCGAATTGCGTTAAGATAAAGGCACTCGACAAGAAATCGAGCTCAAACCGGGCATG
AAGAACTGTGTCATGAAGCAGTGGCCACTGCCTCGTAAACAAGTACTTGCGATCGACAAGTTCTTTGCCGATCGCTTAGCTGCGGGTAATGTGAGCGAGT
CAACTTCCCCTCACAGCTCTTCGAACTTCTGTGTGCGCAAGACCACTGGAGTATGGCGGATAGTGCACGTATTCAATAAGGTGAATGCTGCAACGGTACC
GGCTCATACGCCGATACCGAGGAAGTACGTAATCATTGATGGCATGTCAAAGAGTACTATCTTTTCGTCCATGGATCTGATGGATGGATCCTATCAGATT
CCAATGCGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGTATGCTCTAGGATTGACTAGTAATGCCACAACGGATTAGCAACGCCCCTG
CCACATTCAACAGATGTGTTACAGATCGGTTGGACTGGTGCGAGGCTTCGCACCGAGTTACTTCGACAATGTTCTCGTCCATAGCCGGGCTATGAGAGAA
AAGACAGACGTAGAGGTTCATGGAACTCACGTTCGTCAGGTTGTTAAACTTATGCGCAAGCATAAGCTGAATGTCAACCTCAAGAAGTGAATATTCGCTG
CTAGCGAAACACCACTTCTTGGGTGCATCGTGGGTAAACACGGCTTACGCCCTGATCCAGAAAAGGTTAAGGCGATTACCGACTGGCCTGTGCCAGTAGA
AGTTAAGGAACTAAGAAAGTTCCTTGGTCTATCGGCGTGCTTACACAAGTACTCGCGCAACTACGGCAAGATGACCGTTCACCTCTCTCGTCTTTTTCAA
AAAGAACGAGAAATGGTCATGGAACGCTGATTGTCATCGTTCCTTTAAAGGCATCAAGCAGAGCTTGATGCAATCGCCCATCTTGGAGATTGCAGACCAA
GACGGACCATTCCATGTGGTCTGTGATGCCAGCGATTTCGCAATTGGCTGCGCGTTAATGCATTACGATGTAGACGGAGCAGAACTTGTCACCTGTGATC
AATCCCGTCAACTGCAAGTAGCTGAGCTTAAGTATCCAGTGCATGACATGGAACACC