Description :
From Genome Similarity Track
Location :
Scaffold_153:93985- 95109
Sequence
1124 bases(100 bases per row)
GGAGTCGAGAAGGACTCCCTGTTGAGATAGTTCCTCGAAGTGGACGATGTCATTGAGGCTCGCCACATCGACGATGAGGAAATGCAAGTAGCATTTTCCA
AATCGAAATTGTCAGGCGCGCCAGAACTTGGGCCCTGAATCTTCAATTACACGATCCAAACGTGTTTGGATCGTTGGCGGTCTTTAAGACTCTGCTCAGC
CAAATGTTTGAGCCGCCAAGAGCTGACTTCAGGACTCTTACAGAGCTTCCGAAGATAAAACAAGGTAAGCGTGACGCTCACGCTTACGCTCAGCAAGTTC
ATTACCTTGCAAGTTGTATGGTAGCGAACCCTGTAAGTGAATTCGTGTTGATCACGATATTCTTACAGGGCCTCATAGATGCCCGCGAGGAACCACCTAT
TCCGCATCGAGTTGAAGTTGCTTGAGGAAGCGATAACAACTACGGTGCAAGAGAGCTTTAGTGTGAGACATGCTCACACTAAATTGACCCCCTATCTTCC
TTCGATACGAGTAGAGGCGGGAGGTCCAGAACCAATGAATCTATGCAGTGTCGAGAGCGAAAGACCTCGCTCTTCAAGCAGTAAGCGATTGCAAAAGTGC
AATCGCTGTCAGAAGTTAGGACACTACGCCTACGAGTGTAGTGCTTCACGCCCAGTGTCTTGTAACTCTAAGCAAAGTAATCGACCGTCTGCCAAGAAGG
GCAACGGACGCGGGTCCGACGCTGTTGCGAAGTCACAACAGCGTGGCAGACCGTCAAAAATGGTCGGGGTCAGTAGGGGCGGATTGCCCTACTGATCCAG
CAACCTCAATTGAATTTGTAAATCTATTGATGAAAGTTGCTCCAGACTCACAATCGTTGTGTGCCTCTGCACTTGGCGATGAGGGGTATCTCATCACCTT
GAATTTAGAAGTGACAAAAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCGTCAAACAATTTTGTTCGTCGTCAGTCGCTAGAGGATCGTAGGCTC
CAGTTCGTTGAGCGCGTTACTCCTCCTACGAGGCTGACAGTGCGCCTCGCAACAAGCGCATCAATAGCAGTGATGAAACGTGTAGTGGGATTTCACCACA
CGTTCGAAGATTTGCAGTACAATA