Description :
From Genome Similarity Track
Location :
Scaffold_397:9397- 10756
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_397-snap-gene-0.10Conserved gene of unknown function

Sequence
1359 bases(100 bases per row)
AACCTCGCGATCGCTGGTGCTGTGTCGGGACTAACGCTGCTGGTTGACTCGAAGGCGCGGCGCAACACCATCTCGCTCTACATTTTCGTGCGCTTCCTGG
ACGTTGTCGGGCGCCATTTGACGGCCACGGGCGTGCTCCCGGATTGGAAGTACTCGTCCGAGTTGTTATTCGCGGCCAGNNNNNNNNNNCTCGGCGATTA
TGTATGCGTTCATTTTTGAGCCAATGCTGTTGCCCAAGGTAATCTGCGTGCATCCCTATATATTGCGCACATTGACTTGGTGTTTGCTCTAATACGCGCA
CATATATACAAATACCATTGTGGATACAGAGCTACTACAATTGGATTCTGAACATTGGCGCCGTGACGGACCATGGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGCGTCTGGAGAAGGTCGTGGACGCTAACGGCTCGCCAATCCCATTCCGCGTCTGCCAGCC
CCACTACCACATGTACGTTGATTCGACACTGTGCTCGAAAAAAGTATCATGTATTGATCTTAGGATGACTTTGCGTGTATATTAGGGAATCCTGCACGAC
TCATGGTGTGAAGGAGTGGATCGGCGGCCTCTNNNNNNNNNNTTCCCGTGCACATTTTGCCGGCGCTGATCTTCCGGTTCTCGCAGATCAAGGCCGCGCC
GATCTCCTCGGCCGCCAGAATCTCGTATGCCGCGCTCTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCGTACCAGGTACGCCGCGCTCATGCACACGATGAGAAGACGTCGTCTAGCATAGCGTATATGCTGCTGACAATGCGTGGTCGTGATCCTTTG
TGTGTGTGCAGACGGTGGTGAAACTCGTGATGTGCGCAATCCGCAACACCTTCCATCGGGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATCCTGCTTGCTATATGGTTCATATTTTGGTGTAAACGATTTGCTGATTGCGGTTGCAATGTGTGTATGATGTGGGTGC
AGTTTTCGACCGGCGCGGCGCTGTTTCTGGAGAANNNNNNNNNNAGCGCCGCGCGGAGCTGATGCTCTACTGTCTGAGCCGCGCGCTGGACATCGTGTGG
CGCCTGCTCAAGCGCCGCGGGCTCGTGCGCTATGTGCAGCACAGCGAAGTGGCGCTCTTCTCGCTCTCGATGGCCGGCATCATGTCGAGTCCGCCGGAGC
ATTTCAAGCCCACGTACCTGCGCATCCTGCGCTTTGTCTTCGGCCGCGACATTATTTAA