Description :
From Genome Similarity Track
Location :
Scaffold_648:9391- 12818
Sequence
3427 bases(100 bases per row)
GATACTCATGCGACGGTGCAGACGACGCTTGGCGTGCAAGAAAATTCATAACGGATCATAGTTCACTTGATATTTAGATACATAATTAGGACTTTTGATT
AGGAATAGGACCGAAAAAGTAAACCTACATACAGAACAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCGTCTGGTCAAGCTTC
ATGAGTGTGTTACCGGTCGGTGAGCTCGAAGCTCTGTAGCAAGGGCTCATCCGGCAAGGCCAAGAGACGTTGTGTATTGGCCGATTATTATCGGGAGGTT
TTACGTGACGGCTTATTGTTGCCTATTTGCACGACTGGGAGTGCTTGAATTGCCTCCCTTTTATTCTTCCAGCCGAGTGTTGAACACTCGGTGATCTCGT
AAAAGGCTTACCCGTGCCTGTTACCCTTCCGCTGTTGGGACCACGAGGATTCATAACACCTACTAGCTTTGCTCGTGCTAGTAGCGTGTTCTTATTTTTA
CTGGTTGACCTATATAAGTAGTTTACAAGGTCCAGTTTGTCCCGGTGCAAGGGCAGAACTGGGGTCTTCAGGTCCGCCCGAACGATCGTTTACTATCCTA
GTAGACGTATTGTTGTGGGAACATCCTAACTACATTTGTAGCTAGAGTTCACGTGGGATTTCCAACACCACACGGCTCCAAAATGTTTATGACGTGTGAC
AGCAAGATGGCGTACTGCCACAGGTGATTCTATTTTTTGTTGTTGAATTTTCAATGATGTAACTTACGACTTTAAGGCCGACCTCGTTCTGCTTTGTCGT
AACTTTATAGATTCGAGATTTACGTTGGTAAAATGAATGCTCGCGAAGCACATTTGATCACCAGACGGGAGCTGCAGTAGTAATTCACAACTTCAAGGTC
GTGCTCGCAAACGATCGCCAAGCCTTTCCCGCAGTCACGATAGACCAATATTATTCATCAATCCCGTTAGCTATTGAGCTGCTATCGATGCACGTGTACG
TCGTGGGGATGATAATGACTAGGCGAATCTGGTATGACCGCAACATTGTCGAGTGACGAAAGACCCGGCCAAGAAGTATCCCGCGGGGCTCGTTCACGTT
TTTACGCCCTCTGACTGTGTCAAACATGATCGCCTTCCACTGGTGGGATCGTAAACCGGTCCACTACCGGTGTACAGGGTCAGTGATGACAGCATCCATC
ATCAACCGCAACGTGAAAGGAGAAGGGGCAACGACGGTGGCGTGTCCAAGGGCAGTCAACGATTTCCAAGAATGGATGGGCAGAGTGGACGTGCATGACC
AACTCCGCCTCCAAGCCTTTTCGATCCAGACGTCGGTTCGTTTTGCAAAATATTACAAGAGCCTATTCTTAGGTCTCATTGATTTGGTCATGGTGAATTC
CTACATCTCACACAAGACCGCGTGTAAATTGGCGAGCACATCGGCGATGAAGCGTGGTGAATAGTACGCTGTGCTCCACAGCCAGCTACTTCAGCTGAAG
GAACATGATTTCGCAGGAGTGGCGGTCACACCTTCACCCGGAAGCAAAAAGCGCAGACGGAAACGCGTTAGTCATTCCCTAATCCAGTTCGACGACTGGG
TTACAGTATCTGGAGTCCAAAAACGGCGCCAGCGATCTTGCAAAGTATGCGCTTTGCTCCGCGGTGATCGAAAGAAGTCGTTTCTGACAACCCCTTACTG
TGAGAACTGTTCCATAGACGACGCCAAGTGCTACCTATGTCCAAGAGCAAGACGTGAGTACAGAGGTACGATGAAGACTTGCTTCCAGATATGGCACGAT
GATTTTGAGTGCGGATTCGCCATCCCACCCACCTTGGGCAAGCGCGTTGTCCTCCGGCGCCCTGGAAAGAAAACCGGTGTGCGCAAGAAAACACGGCGTG
AGCTGCTTCGTGAAGAAGAGGGCGAGGCGGACGACGAGCTGCGTGGTGATGCTAAGGAGCATAGCGAGGACGACAGTGAGTTCGACCTGTAGAAACGCAA
TGATCAGGAATGTTGTTATAAAATAAACTTCCCTGAACCGTCGTACCTTTTGTCTCCTAATTTCTGAAATGATTGGGTTCAGACTCCAACTATCTTCCGT
ACTCCCTTTTCTGCAATCCCCGAAGTTATGACTTTAAACTCCACTGTAGTAAAGAAAGTTGTGAATCTTACGACTAAGCCTAAATTTCATCTGTACAAAT
CTATATACCTAGCCTCATGTGAATAGTCTGCGACTTTACAAACGTCATGATAAAGAATACGCCATAAGTTACGACGTTCGCTTAGCGGTTCCGAGATACG
AATCCTGGGAGCCAAGGGGTTAAAAAGGAGCCCATACACAGCAAAAATGATACCGCTCTGTAATGTGTGTCGTAACGTGTTGCCCAGTACGTATAAAGAC
GTTCTTGCTGTGAAACACCGGGGACATACTTTTGAAGATACACGATGGAAAGCTACTCAGCAAAGCTTCGCAAGCAATTTGAAGTATTATTAACCACCTC
CCATCCCATACAATGTTGATACGTTCATGTTCACTTGAACCTATCATTACGATACATTGTACCTGAGTTAAGTATACTAAGGCGTGCGTGATTATTGTGC
CGCAGTGCCAAAATCAATTGTTTGTATTGGAGCCCTGGTGTAAACTGCAAAATCGCAATCGTTAGCACGTGTAGCCTATTCTGTGCGATAATAGGAACAA
CATATCTAAATAGCATGCCCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAGGTGGTCGGCCCTCCTCTACATCAACCAACCATGCCCTAGCGTCCGCGGAGCGGGCGCCAAGATCGCTAGTCCCCCCCCTAGT
GGAGTGTGGTGTCTGTCTGTCAGTCCGTCCGCGGCTAGGGTTAATAAAACTCACGCTAATACGCGTGTTCTACTGGCTGCCGAGCGCAGCGAAGGCGGCC
CCAATTGGTTAAAATCGCAATTTGTGGTGTAATGTGGTTACACATCGTACTTAAAAGTACCGTTCAAATTTCGTTGTGCTCTCATTTTCAGCTGCGGTTC
GCCAGGCCACACAAAGGGCGCTGCCTGTGTGCGGGTTAGTTTGCATTGGTCGACTTCGCCGACGAGCACACACGTATTATATGCTCTTATGAGCTGGTAG
TAGAATTTGTAGGACCGGGTGACACAT