Description :
From Genome Similarity Track
Location :
Scaffold_182:939- 7121
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19758hypothetical protein
Phypa_INRA-310PPTG_19759hypothetical protein

Sequence
6182 bases(100 bases per row)
TTACCTTTCAGTGAACTGGTGAAGTCCCTAGGGCATACGGATCAAGTGTATTATCCAAGAGGGTTCTGAGCCCAAGACTTTCGGATTTTGTGCGCTAACG
TGATCCAAGATGTTAGGACCATTAAAGTATACGAGTGAAGGTGTCCCAAAGAACTGGGATGCGAAGGACTGGCAGCAGTACAAATCGGCGATGGAGATAG
TCTTCAAGAAGAAGAAGCTCACGGATATCGTGAATGGAAATCTCACGAAGACAATGGTCTTCACGTCGGAGGCTGAGGAAGAGTTTGATGATCATCAGTT
GACCATCATACACCTCGTCGGGATGTCGTTGCCAGCAGAAATCTTCCACCAGATTCGCGACAAATCCACCGGGACCGACATGTGGAAGGCACTCTGCGTA
ATCTATGAGAGCCGGGAGAACCGGACTACCATGGCTCATAGAGCTGAGAGCATTCGACACGAGCTTGATATGCTCAAGCTGTTCTCGGGCGGAGACGTCA
ACAAGCACCTGAGTAAGATGTTCAACTTGCGGACGGAGCTGCTGTCTCTCAACTATCAATTTGACGACACCGCGATGGTGGAGTTAATGCTGAACAGTCT
ACCGCACACGTACGAGTTTGAGAGCTTGAAGAGTGGTGTTCGGTACAATTGTGCTGACACATACATCGCTCCAGAGCGGACTCGAGAGCTTATTCGTGTC
GCCAACTCTCGACAGAGAGTTTTTCAAGCCAGAAAAGCGGTAGTGGTGATAAGCAGACGGCCGATGGTAATGGGCAAAAACGTGAAAAACCTGAGAAGTC
TAAAGACACAAAGAAGAAGGTGAAAAAGTGCTTTGTTTGCGACAGTACTGAACACCTAAAAAAAATATTTCGGAGGGTCCGCTGAAGGTGAAGAACCAAG
ACGGGGCCGCTGCTGGAAGCGAGCAGAAGAAGAAGGCACGTGCAAATGTGATTACTCGTGTGGACCACGGTGAGTCATTAGACTCAGATACAGAAAAAAG
TATCAGAAGAAGTGATGGACGCTTTGGACGCTCTACTGATCGACGCCAGACTGCTGGCGCAGAACAGCGAAGAGAATGAAGCGGGTTCAAACGAGGAGAA
AGAGGCAGGAGGTAGTGGAGCTGATGCTACTGTTACCTGGTGGTACGACGGCCTCGAACTTGACGAACAGGAAGTGGACACCAGTAGTGGGTGGTGGTAC
TTCGATACGGCCGCTAACGTGCACGTGACGGGAAATCCGTGGTATTACGTGACGTTTACGCCGGATTTGAATCAGTCTCAGCATGTACATGGAGTTACGC
CTGCGTTGGCATCTCGAGTGGCTGGAGTAGGAGCTGTAGAGCTAATAACTGGAGTTGAAGGCGAGCGGAAGGCAGTGTACTTAAGTGATGTCTTTTACAT
TCCTGGTGCTACACATGGCCTGCTATCAGTTGGATTAGCTACGACACAAGGTTTTGATTTTGATTACTATGGACAATTGAGGTGCTTTCGCGTGAGAGAT
GAACACGACGATACTGTAATTGTAGCAACGCCGGAGGATGAAACTTGGAGGTTTCAAGCGAGTCATCCATCCATAAACGGATTTAACAGTTTACAGGATC
GGCCGTTGTGCAATTTTATAGTTGCTGAAGGGGTGACGTCTTTGAAGCTTGGCACGAGCGATTGGGGCATGTGTGTCCACAATACTTGAAGACGATGGTC
GACAAGAACCTCGTTCGTGACATGATGCTAAGGCAGAGAGAGCTAGGAACTTGTGACGCCTGTCATATCGGCAAGCAGAAGCAGCAAAGACACTGGAAGA
AGCTGGATCGCAACACAAAGACTCCGAACCAAGTGATAAATGCTGACTTACTGATACCTAGTAAAACTAAAGGCACTAGGTTCGAGGCTGTTCTCATACT
CATGGATGGGTACACTCGCTTTGTGAGAGCTCACATGTTGACTAGCAAGTCGAGCGAGGTAGTGAACCAGCACATGAAAGAATACGTGCTCTGGGCTGAA
AGACAAGCTGGTCGTCAGCAGGATGGCCCTATTCGAGTGAAGTACAGAGTACACCAAGCCTTGACAGACAAAGGTGGTAAATTCGTTAATACAGCAATGG
ATAACTGGTACGGAGTGCACGGCATCGAGCATGTGAAGGTGGGTCCAAAGAGTTCACAGCTGAACCTTTGCGAGAGGACGCATCAATCTCTCGTGGAGAT
GACGAAGTCGATGATGCATGATGCTGGATTCCCTGTTAGTCTGTGGCCTGAGGCGCTGCGTAACGCAGTGTACATCAAGAACAGAGCCTACAATAAGGGA
ACTCAGAGCATTCCCTACGAGATGATGTTTGGGATTAAACCCGACCTTCATCACATCCGCAAGTTTGGTTCGCTTGCATATGTGCATGTACCAGTGACAC
CAGGTCGGAAGAAGCACCATGATAACGCACGACTGGGCTTTGTGCTCGGTTATGCTGAAGATACCGTGGGTTGTAAAGTCTACTTTCCTGATGATCGTAC
AGCTAAATTCGTATCGGATCTTCGCATTAGTGAAGACGTGATGTATCGAGATCGTCATGGAGTGGATTTGGAGGACGACGACTTGGAGTCGTTGCACTTT
ACGAAGCGCATGGAGCCGAGTACTGAAAACTCAACGCTTTACGAGTCTATGGATCTGAGTGAAGTCAGTCTGCAACTCGAACGCTGCTCCGATGATGAGC
GAGGCCACGCTCGAAGCGACCAAAGACCTCGAGAGAGGCGATAATGATAATGACGATACTGCGGAACGAGTTGACGAGCGAGATGAGGTGATGACGGAGC
TTAGGGAGGCGCAACAAGCGTCATTACCGTCAAGAGCGTCTGCAAGTTGGACAGGACTGGAAGAAATTGGGGACACAGTGACTGAACCTCCGTGTGTTCC
GGATGTTGAAGGGGTGACGGCGGGTTTACCTAGCGTACTGACTGCAATGCAGAGTGAACAATGCCAAGACCAGAGTGATGATCTTGTACAGAATAGCGGT
GTGAATTCTGACGACTCAGAATCAGCGAAACTTACGACAGTGTATGGATGCACGAAACCTGAAATGGCAGGTGATAATGAGTCTGCTGTCAGCGTGTGTG
GTTCATTGGAGGTTAATGCTGATGGGAGTTCATATGAAGTGGGCATTGAAGGACTACACGCAAGTGAAAACCTTTCTGATTCGGTTGTGAATGAAACGAA
TCTTGTAGCCGATGAAGACAGAGATATGCTGGTTGACGTTGACGAGAAACTCAGTGAAGATGATGACAATGTCACCGTTGCCAGTACGTGCGAGAGGTTG
GTATGCAAGCGCCAACGAGACGAAACTAGCTCGGAAATGGGTAGTGTGGAGAAATGTGCGGAACATGAAGGTCCGAAGCGAACTCGAACTGGTCTGCGTG
AGTATCACGAACGTCGTCGGCCTAAGTATTTGGATGACTATGTAGTCAACGCGGTGCAGAATACGTCGCGTGTACTGGATGAGAACGGACGTCCTATACG
AGCAAGTGATGTCCAGATTCCACGCAACCACCGCGAAGCTATGCGAAGCAAGTACCGTGACTATTGGCGTGAAGCCGAACTGGCAGAGATGTTAGCAATG
AAACGACGTAGAGTTCTGGAGGAGATTGCGTTCGAGGATGTTCCGAAGGATGCTAAGCCTATCAAGACACGCTGGGTCTATAGTGTGAAGTCGGATTTTC
AGGGTTTTGTGATTCGCTTCAAAGCTCGACTAGTTGCTCTTGGCAACTACCAGAGACCAGGAGTGGATTTCACTGATACGTTCTCGCCGGTGGCGCGAAT
GTCTTCTTTTAGGCTTTTAGTGGCATTAGCTGCGGCTCTGAACCTGAAGCTCTACGGAGGGGGTGTTGATACGGCATATCTCAATGCACTACTTGGAATC
CTGCAGTACGTGAAGTCAATTGACGGATTTCCGTGTGAAGTGGATGGCCACATGTATGTGGTGATCAAAGCGTTGTATGGGTTGAGGCAGTCAGGGCGTG
AGTGGAACACTGAGATTAACCAGTGGCTTCTTGCTCGTGGATATCTACGATCGTTAACCGAGCCCTGTCTGTATTATCGCATTGATGGAGAAGATGTTAT
ACTTGTCCTTGTATATGTGGACGATATTGTGGTAGCGAGCAAGGATGAGGAAAGCAAGAATGTGTTGTTTGAAGCATTGGACCGAGAGTATGGACTCAAG
GACCAAGGACTATTGACTTCATATCTTGTGGTTGAGGTTCATCAGACAGAGGAGCAGGTTACAAGCACTCAGACAAAGTATACACACGAAATTTTGGAGA
AGTTTGGCTACGGTGAAGCTCATGCTGTGGGAAATCCCATGGAAGTGAAGGCCCGGTTTGTCTCGTTGGAGGAAGGCGAGACTAGCGACACTAGTTTCCC
GTACCGTGAAGCTGTGGGTATGCTGATGTACTTGGCAACAAGTACACGTCCTGATCTGGCATTTGCACTGCGCCAGTTGAGTAGATTGGTGGCAAACCCA
TCAAGTAAGCACGTTGGTGCATTAAAACGTGCCCTACGCTATCTTGCGGGTACTGTGAACTATGGAATAACCTACGATCGACAAGAGATGAAGTCGAAGG
CTATAGTACTCGAAGGACATTGTGACATTGACTGGGCAAATGACCCAGAAACTCGGAAAAGCACGACAGGATTCGTCTTCACATCGGCTGGTGGTGCCAA
TTTGTGGATATCGAGACGACAGTTCATTGTAGCCTTGTCCACTGCTGAAGCTGAGTATGTGGCTGCATGTGAGGCTGCTATGGAGGCGATTGCAGAGAGT
AACATCTTACAGGAAATTCCCCCGTACCACACTGTGGAACTATGCATTGGTATTGACAACCAAGCTGCACACGTTCTAGCTACGAATCCTACCTACAGTC
GCCGCACTCGACACATTGAGTTGCGTTGGCATTACGTGCGTGAACAAGTGGAACGTGGAGTGCTGAATCTACATAAGGTCAAAGGGGATGAGAATCCTGC
TGATGCTTTTACGAAGGCGCTCGACAAGGTGCGTCTCAAGAATCTGGTTGCCAGTGTTGGTATCGGAGATGCAAAGTAGTCAAAGCTGATGCTTCGAAGG
AGGCGTGTTGGAATCCAGATTCATATCTAGGACCAGAGTCAACGTGAAGTACGAGACGGATGGTCAAACTACGGGACCTGGCACAACTGAGTTGAGCACA
AAGGCGCTATGCGGTATAGTGAAGACAAATGGTGCCAGGCCAATGCATGGGAAGCGACTGCAGGTCGCAAAAGAACGTTGAGCTGAGGTGTAGTGAAGCT
AACGATTTAATTCATTCCTTCTTTTACCTTTCAGTGAACTGGTGAAGTTCCTAGGGCATACGGATCAAGTGCATTATCCAAGATCATGACCGTCTTCCGC
CACCCCGTCGTTGCTGTCTCGCACGGACCCGGTCCGCTGTGGCTGCTATCCTCGGGATTCGCTGGCATGAGCAACAGCTGCCTACCGCCCGAACACTGAC
CACCACCTACGAAAAGCTATACCCAACGACGAGAACCTTCCCAAACGCATCCTGTTCGAAATTACACACTGGGAATCTGAAAGTAGCGGATTCGAGATCT
CCAATGCTGCCAAGCCCGAGATGATCTACGACTACTACGTGTTTCCACGAGACCTACGATGTCGTGTATCCTGCTGAGGGTGGCCCTGCTTTCGCTCAGA
AAGTGAAGGACCATGCGCGCTAACCGAGACCTCACGAACCCGCTCATGCCGTGGGCAGCGGCGTTCCAAGGCTGGCTCGACAACACACTCACTCCGGAGT
CCAGGCTGAGCTATAGCGAACGTAAAGCTCACATGATAGACTGGCCTAACGCTCCTTCGACACCCGACCACTTCGTTCCATTTGTCACTGCTGCTGGTGC
CGGCATGGAGGAGAACAAACCTGCGGCGGAGAAACTTTTTGGTGGATGGGAAATGGGTCATCTGTCGTTTGCCAGCTATGCCTGGGGGTATTGAACATTA
AGCAGCCATCTCTAGACAAGTAGGATTCTAATTCATTTTACTATTGCCTCGCCGTTATCTAGTATCAGCTCAAAGGAGCACTGTGACGTTCAACCGCCAT
AGGTCAGACCACATGAACGTTGCAGGGAATACCAATCTAGCCGTGTCCTTCACTTTGTGGCCGTGCACCTCATACACGTAGA