Description :
From Genome Similarity Track
Location :
Scaffold_20:939- 3386
Sequence
2447 bases(100 bases per row)
GAGTATTCATATGTGTTCCCGGATAAGATACCGGCTGAACTCCCTGCTGACCGTGGGGTTCGGCACGAGATTGATCTCGTGCCAGGTTGGAAGTATTGTG
TGACACGGAAAAAAAGTGGCCGTTACCTCGAGATCAAGTCGAGGCTATTGACGCATTCTTCGAAGGACGCCGAAGGCGGGTCACGTGCGTGAGAGTATCT
CACCACACTCGAGTCCAACCTTCTGCGTGAAGAAGGCTACGGGAGGCTGGCGAATAGTGCATGTGTTTAACAAACTAAATGATGCCACTATTCCTGCACA
AACGCCTATTCCCAGGAAGGACATGGTGTTAAACGCCATGTCAGGGAGCTTCATCTTTAGCGCCGTCGATATAACCGATCGCTTTTACCAGATTCTGATG
AGAGAGAGCGACATACCACTCACAGCAGTTAGCACCCCGAGTGGCATGCTATGGGAATGGCTAGTAATGCCACAAGGGTTGAAGAATGCACCTGCCACTT
TTAATCGCATGGTGTCTCAGGTGCTGAGACCATTACGGGACTTTGCTCCCAGTTACTTCGACGATATCTTCGTCCACAGTCGCGCTGAGGGCGACCTTAG
CGAGGTCCAGGTTCATCTTCAGCACTTGAAAAGAGTATTCCAAGTCATGCGAGAGAACAAGCTCTATGCGAATCTCAAGAAGTGTGTCTTCTGCGCACCG
GAAATTCCGGTGCTGGGTTGCTATGTGAGTAAATCAGGCGTTCGAGCTGATCCACGGAAAGTTTCGACCATCTGTTCTCGGCCCACACCCAAGAACCCCA
CGGAATTACGTCAGTAGCTTGGCTTGGCTAATTACTTGCATAAGTATACAAAGAACCACGCCGGTTCTATACAGCCTTTATCATCACTTTTGAACAAAGA
CGCCACGTGGTCGTGGCGTCCTGAACATCAAGCAGCCTTCGACGCAGTGAAGAAGAGCCTGGCGTCAGCGCCAGTGCTGGTCCTACCGGACGGCTCCAAG
CCATTTCACGTCGTATGCGATGCAAGTGAGTTCGCGATCGGTTGTGCCCTCATGCAGTTTGATCATGAGGGCCGTGAACGAGTCGTGAGCTATAACTCAC
GACAAATGAAGTCAGCGGAAAAGAACTGTCCAGTTCACGACAAGGAGTTGTTATCGATGCGCTACGCACTCATCAAGTTCCGCGTTCACCTACCCGGTGA
ACGCACGTTTGCTTTGTACACTGATCACGCATCGCTGAGCACAGCGAGGAAGAGTCCGCACCTTTCCCAGCAAATGGCACGGTGGCTTTCGTTTTTCTCC
GAGTATAATTTCGTCTTGCATTACAAGCCGGGCAAGAACAACATTCTTGCCGACGCTTTGTCGAGACGTCCCGATTATGATACTCGGACAGCGTTGAGTC
GTCAGGCGACTGACGACGAAGAAGAGGATGATCGTTGTGTGATGTGTGTGTCGCTGAACTTAACTCGGGTCAGTCCCGAGCTGTGCTTATTCGACGAAAT
CGTCGCGGATTACGCGAATGATCCAGACTACGCCGATATAATCGCTTATCTACGCGGACACAGTGACGTTGCAACTGGGTGCTCTTTCGAGAACCAAGCG
TGATCATATTCTGCGATATAGTTTGGACGGGGACCTAATCCTGTACAGCATCGATCAGTTCGATGTTCCTCGTACGGTGATCGCCAATGACATGGATTTG
CGCGCTCGAATTATTCATGAGTACCATGATGCTCCAACTGGTGGTCATCTCGGTCGCGAAAAGACTTTCGCGGCTGCGACTTCTTCTGGCCTCACATGTA
CAAGTGGGTGCGCAACTGGATTCGTACGTGTGAAATCTGTCAAAGAGTGAAGCCATCCATCGTCCATCATCGCAGGCTCCCCTGCGACCGTTGCCAATAC
CAACTGAGGCTTGACGCTCAGTTTCCATGGATTTTATCTACGGGCTCGCACCCGATAGTCAAGTCAGAACGGGTATTCTGGTATTCGTGGACATATTTAG
CAAGATGACACATCTGGTTCCTGTTCATGCTAAGGTCACCGCGGCAGAAACCGCAATGTATTTCATCGACGCTGTGTTTCGCAATCATGGATTGCCGGAG
AACATTGTTTCGGATCGCGATCCTCGATTCACATCCGCGTTCTGGACGTCACTTTTCGAGCTTCTTGGTACGAAACTACGTATGTCGACAGCGGCCCATC
CGGAAACGGACGGGAAAACCGAGCGAGTAGACCGAGTACTCGAAGATGTCCTTCGAAGTCACGCTATGTCCTTCACGAGTTGGAGTGCATTCCTACCACT
TGCTGAGTTTGCGCTCAACAATGCTGTACACGCGTCGACAGGTTTGACGCCATTTTTTGTGAATTTGGCTCGACATCCTCGATTTCCTACACTACTCGCC
GTTGGTCGCCCCACGGCTCCTCGTGACTCCACTCTGGGGGAGGGATG