Description :
From Genome Similarity Track
Location :
contig_9:9389- 14435
Transcript NameFunction/comments
g2571.t1hypothetical protein

Sequence
5046 bases(100 bases per row)
ATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGACCTCGACGTAACCCTTGACATGGCCACATACA
GCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGAT
AGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCG
CCTGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCA
TGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTC
GTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTG
GTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAA
TAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTAATGTAGTCATTTCCCAGATCGTT
GTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGAGGTGGCAGCCGTGCGAACACGCATG
TTCTCTGTCAGACGCACCTTCTGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACCGGGA
GAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACATCACGAAGCGTTCTATCCACTGCCTCAAA
CGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCCGTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGAT
TCGCCGTCTATCTTCAATGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCAGAGAAGCAATCCCACTGGAAGCGACCGCGATTGCAA
TTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTG
TGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCGTTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCA
TATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGGACGG
AGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGC
ATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGG
TACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCGATACGTGGGAC
ACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCGGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGA
AACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATATCCTGGTAC
AGCATTGTCTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATGGTGTGATTCCCACGACCAAGGACACGCTCCG
GGTCTTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCGACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAA
GCGGATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCC
TCGACAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAAT
TGTACTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGTTGTCGTACTCCCTGCCCTTCCATACCAGGACGCCTTCAGCTCG
TCGACGCCGTCTGTAGACCGGATAGCCGTTCACATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAA
GCGCATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGCTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAG
ACACCATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGAC
CACGTAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGTTTTTGCTGCCAGACACGGGCTACAATATCGGGG
CGGTCCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATT
CTCTAACAATGGCCATTGAGTCTTGGTAGGACTGGTACATCGCTCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAG
AAAATGGGTATCACCACCACGGCCTCGATCAGGGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATT
GTACCTTCGTTCAGCAGTGCGTCCTGAAGCCCTCGGTACTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATT
TAGCGCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTC
GCGAAGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCCGTGTAGGTCCAACCCAGCTCCCCATACGGAAGCAGAAGAGGGTAC
TGAAGCGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCT
CGATGAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGTCGCT
CGTGTCTCGCGAGCGCACTTGCTCTCCGAAACTCAGGAACTGCTGAGCAAATGGGTTGTGCTGCTCCATCATTTGCTCAATGTCCATCAACGCCACAGGA
TCCAAGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGG
TGGCGGGATCAATATAGGGGAGTAGAGATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATC
CTGGTTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTGCTGTCGGCTGGATCCCGGTA
CAGTTGCAACAATCTTGGAGGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCTCTTTTGATTCGCCAGGCCACTTCCAAGCGCCACAATGTTCAC
AAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTTGCCAACGCCTCTCCACG
TCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCCAGTGCTTCTTCCTCAGTCTGTTCTCTGCGGCGTTCCGCATGTTGCTCTTGGTTTACC
ATGCGTTCTTCGGCGCGTTCCTCCTGCGTAAGCTGTGATTGCGCTCCGCGTGTTGCTCTTGGTTTACCCTTCGCTTCAGCACGCTCCTCCTGCGTAAGCT
GTGATCGGCGCTGCTGTTGCTCTTGGTTTCGCGCTTCAGCGCGCTCCTCTGTGTAAGCTGTGATCGGCGCTCCGCGTGTTGCTCTTGTTTACCACCGTTC
TTCGACGCTCCTCCTGCGTAAGCTGAGACGGCGCTCCGCGTTGTTGCTCACGATCTGTTCTGCGCTCTTCAGTGCGATCCTGTACACTCCTGTGAAGCGC
GCGAGAAGCACTGTTGCGTTCACGCTCCGCGGCGTGGACCTCTTCGTTCAGATTATGCCGACGTTCCTGCTGTGCGATCCGGTTTCGCTCTCGTACGTCC
TGAAGCTGCTCGGCACGGAGCTGGGCTCGCCGGGCTAGCTTTCGCTCCGCGTCACGCCGCCGCGCACTCTCCCGCTGAGAGTCGGTCATGTTACTTCGTC
TGGAACGCGCTCGCTGCGCCTCCCTCATCCGACGTGGATTTGCTTG