Description :
From Genome Similarity Track
Location :
Scaffold_902:9387- 11610
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_902-snap-gene-0.3Gene of unknown function

Sequence
2223 bases(100 bases per row)
ACCGATGTGCTTGACGAAATATCTAGCCTGGAGGTACTGATCATCACTCACCACATCACCATCACTCGCAAAATTTTAAGAGGTCCATGGTACTTGTAAT
TTTTAATCCTGCGTGGCAGCCACACAATGCAATTTCAAATTAGAGTGCAGAAAACGGCCATCGCATTTTGGCCTTTGTAGTTCCACGTCTCTGGTGGAGT
GACATTACCACTTGTATGTGATCGTGTCCTGCTGTAGAACGGCTTACCCTCGGGCGTGTGTCACATCCTCCTTCCCAGCCTTCCTCCATTCGCAGATTCA
CCAGCTCCACCACAAGCGCCTCCTCCCAACAACCAACACCATGGCGACAGCGAACAATGTGGCGCTCCACGTCCTCACGGACCGCAGCCTCTTGGCGACA
ATCACGGCCTTCTCCCCCAGTCTGGAGGAGGCAATGGACTAGCTTATGGACAAGCTCATCTGCGCAAGCGACGAGTACTACTACCTCAATGCTCCGTACG
CGCAAGACATTGAGCTGTGGCAGCGAGCGATCTGTGTCGGCGACAAGCTGACGCTCGAGGCGTTCCGAGTGCTCTCGGAGACGGAGGATATGGATGCTGA
ACTGCACGAGGTGCTCGTGGATATCATGAGCTTCGCTGTCTTCCACACGAAAGACCTGGCGCTGCTCAACTGGATCGTCGACAGATTCGATTACTCGGAC
ATGTACGCGCGTTATCTTGACAGTACAGCGCGCACGCTGGGCGAGCAGGGCGACATGGAGATCATCAACTGGGTCCTCAGTCGCGACTTTTACATGCTTG
ACGATGTGATGTGTGGTGCTGCAAGCAAGGGTCACGTGGAGCTTGTCAAGTCCGTTCTCGATTTTCACGGAAACCCCTACTTTGAGTGCGGACAAGACTT
GGTCAGGGCGGCGATTGAGAGCGACCAGCTCCCCATGCTCCAGTACGCACTGGAGAACACGCCGAGATGCTATCATTACAACGCCTGTAGGGCTCCCGAC
GATATTAACTACGCCGCCAAAGCTGGAGCTCTCAACGCCGTCCAGTTCCTGCACGAGAGACGACCAACCGCCTGCACCATGGACGCCATGGACAACGCCG
CTGCAAACGGCCACCTCGCTGTCGTTCGATTCCTGCACGAGCATCGAGAGGAAGGCTGCACGACCAAGGCGATGGACGAGGCTGCCACGAATGGCCACCT
TGCGGTCGTCGAGTACCTCAACAAGAACCGAGTCGAGGGCTGTAAAGTGGATACGCTCTTTGAGTGCGACAAGCGGAGACTCGAGGATGTCGTCAAGTAT
CTCTGCATGCGGCGTCCGATGGCGAATCCACAGCGCGCCATCGCGAGGGCGCGGAGTGAAGGACGACTGAAGCTGCTCGCAAAGCTGGAAGAGAGCGTGC
GCTTCGCGGAGGCGACGTACGCGTACATGGACTAGTTGAGCTCCTACATAAACTGATGGCCGATGCGAATACGAGATACCATCGACGTGTTTTGAATGAT
ATCCAGCTCTTCTGGAGCCGAGTCTGGCTTCGTGCATATCTACTATCTCTTCGGGGCCCTTGTGACTGGGACTGTAAGGTTGTTGTTTTTTGTTCGGTTG
GCGTCTTCGACAGTCCCTTACACCGTCGAGTTGGATTTGAGCAAAGGTGACAGGAATCTGATCAAGTTCATGCAAGGCTTCGCTGGAGTAACGAGACGAG
GGAGGCTTCCTCTGAGGATAGTGTCGTGTGAAGTGTCCTCGATGATGAGCACAGTCACTTCAATCACGACACCGACCGTGCGATCTGTGAGGCTGCATCC
AACGGTCGGTTACCTCCGGATCGCCACGTCTCAGTCCAACAACCTCTTTCGAGAAAAGTCATCGACGCCGCTGACCGTGCTGCTAAGGACATTCGAATTA
TTTCATTCTCTTACAGAGCGGGCGCTTCTCATTCACCCCAGAGGTGATGCACACTACCAAATTCAACAGCCTACCCTGACCTCGATTCCCTCGAAAGTAT
GCAGATTTTGTGTGGCAAAATGTGCTGGTTTTGTGTGATACATACCGGTACACAACCGGTATCAACATTTAACCAAAAACACCAAAAGTAGTCCATACAA
AAAGCAAGTCAAGCTTTTGCTTTAGCCACGATTCAAGACTGGAAAAGACAAGCAAACATGAACAACACAAGCTGCTCGCGCTCGGCGCGTGACGACAGCG
TGGCACTCGACGAGACGCACACA