Description :
From Genome Similarity Track
Location :
Scaffold_94:93863- 108222
Transcript NameFunction/comments
Physo_141107hypothetical protein
Physo_141108hypothetical protein
Physo_141109hypothetical protein

Sequence
14359 bases(100 bases per row)
GTTCCTGAGGTGATCAGATCCTCGACGATACTCCCGAAGGTTTTCCGCAGCGTATCTCTCGTAGCGTAGGCTTTTTTCTCGTTGGACTGTGCGATGAGCT
CGTCCATGCAGTTGTTTGTCGCAATCGGGATGTCATTCAGCACGAGAGTCGACTTGCTCATAGCAACGCGAATGTCGTTCTCAGACATAGTCGGGTTGTG
CTTACGGAACTCTGCGATTGTCATCCACGTGCGATCCAGCAGTCGCTTCATGTCGTAGCCGCAAGTTGAATTGGATTCCAGCGAAGTCTTCAAGTTGGTG
ATGTCGTTTTTGCCGAGCGACTCGGCCGACTCGCCCATCGAGACATTCTTCAGGAAGCCGGTGAAGCTTTCCCAAGAGGATACGATTTCGTCGGGGTGTT
TCATGACCTCCCTCAAGGTCGTCTCAATAGTGGTGACAATCCTATCGGCGAGCTTCACATTGTCCGGCACCTTCTTTCCAAGGCAGTAAGTGACTGCCAC
CGGAATGTCGATAACGATATTGTCCGTCTGATAGAGAATCGCCATCACTTTTTCTTGTGGAGTCTCGGGGTCGGATGTCTTGACATAACGAACGTACTTG
ATCAGCGACTTGGTTAACCCCAGCCAGGCCTTGACGCACTTGAAGGCCCTTTGGAATCCCTTCGCCAACTTCCAGAATTTGAAGAACACACCCATGGTAG
TATAGGAGTATAGGACATCATGGCCTGGGTGACCGCAAACGTTTTGGTTGCGATTTCCAGCCGGCAATCGTCGTTCTGTCGGATGCACTCCATTCCACAC
TCGACAGGGTACGCGTATGGGCATTGAGCCCAGCACATTCCGAGCTTGTAGCCGTAACCTAGCGGGCAGTTCTTCGTGATGTGGGTCTTTCGGTAGCACG
CCGAAGAAATCGCAGTGTCGAGCTCGGTCCCCACCCAATTTGTGTAAACCGACTCGATCGTGCTGGTCGCATTGACCACGCTGCCAATCGCGAACTGTAG
GGCCGTGGAGCCCGAGCCAACGGCCAAATCCGAGTCGTCAATGCTGTCGGACGATTCATTGCTGACTGCGGAATCGGAGTCGTCCTCGCTGTCTTCAGAC
TCATCGTCACCACTTGAAGACTTGAGAGTGGGTGCTGTTGTTTTCAGTCCATGTACTCCGGCGGTCGTGAAGTTGTCGTCCGAATCCGTGTCAGCGGGCG
CCACCGTAGCAAGTGGATTGGAGGTTCTGGGCCATCCGCCAAATGTCAGGATCTTGGCCGAGGAGAGCCCGGCGAAGATGGCTACGAAGACGGCAAACAG
TACATGTACAGCCAGCCTGGACATCCTGCTGAGTCTCGCTCGCGGGTGCGAGGAAGTTTGATGAGCCTCGAGTTGGTGAAACGAAGAGTGAGAGCGAGCG
GAACCCTGCTCTCGATACTTTCTTTGTTGCGAGGGACCTCCTTGCTCAACGACAATCTCGTGCTTGTCGGCGCTGTAAGCAGCGACGGGGTCATGGTGGG
CCCGATTTCACCAGAAGCATGCTTACCGTGTTGTAAATCGGTTCCGGTGGACATGTCCACGGGCACAAGCGAGACAACATTGCACGGCTTCAACAACACA
CGACAAAGACCTCCAATCATCTTGGTGCGATTTCGGCGACACCTGGCCGTGTGTGCTCGTCGCAGCGACGGTCGCTGGCAAGCACAGCTCTGTTCCCGAG
CTTCTGCGCCGCCATCTGGTAGAGCAACTAAAAATATGCAGACCCACACGCCACGCTCGTCACAAAGGCTGCTGGCTCCTCCTCCAACCACCGTGAAATA
CATATCTCGCAGGTGTAGGCTCAGCGAGAGACACCGCATCTTGTGACGTTGAGGCGCGTAGGATGCAGAAGGGGATCGGCGCTGGCCGTTCTCAACGAAC
GAAGAGCTAGGATTGATAGGTAGTACAAGTACAGTACTATATGTTTTAATACTGTAAAGCATTTTACTATAATAATACTGTTTTCAAATAGGGACTTCAT
AAATACTACTATGATATTAGTATGGATCTGCAGCAGTTCTACATGTACACTATAAACGGTCTTTACACATGCCAAGTAAAGACCGTTTTTAAGACCGTTT
CCAGTGTACATGTATAGCTGTTTTTCACATTTACTACAATGTAGTACGTGTGAAAAATAGTTTGAGGTCGGAAATAGTGTTAGTGAGACTGAAACTCCTA
TAATGCTACCGCAATACTTCTCTGGCCCACTTAAGAAACAACATTCCGCATTAAACCTCAATTTGATGTGGACCCAACCATGCTGGCATTTTTGTGGTAT
GCACACTAGAATCGGTATCTGTGCCCGTGGGGCGCGGGGCAGTGCACCTAGGCTCACACGGTACATATTGATACATGCCGGTGTTATTAATACCGATAGT
ACCCGGATAAACATGCAGACCCAGCCAGACATGCTTTGAAATGCCAATAGCAGGAGAACACACGCTGTCTACAGTTGCTCGTCAGAATGGATGCCCTTCC
AATTATCTGCGCGCGCTGCAAGTTGCTGTATGCGATGAATACAGGCAGCAGCCCCGTGCCTACCACTCGCCGTGTTGGGTAAGTAAGGGCCTGTCACAAA
GTACTAAAAGTTGCGTCCACGTGATTTCGGCCGCATGTACTTGTAGTATAGCGGACCGCTATACCGACGGGGAAGGACTCAACACTTAGTCAACGTGCTG
ATGCTGCTTGAGTACGTATCACATATGATTGGGTATAATTAACTGTATCATCTTACTATTGGCCAAAATAAATGGGTCTGCGTATGCCGAGATAATCGCG
TAGAAAAACCTCAAAACTGTAGCCCTTCTAACTCGTCTCCAACAGGCGCTACAACACCGACAACCGAACATAAGGGTAAAGCAGTCACTCGCGATTACGG
TGATATATTATTTTCTAATATCGCTAATTTTTGACGGCACCTCGCTAAAAAACCTAATGTTGCCTAAAACGGACTTCAGATAAAAGGCTGTTTCTCTTTT
CTTTCTGCTGCTAGATTTTTTTAAATCATAGGGTGAAACGGAGCAAATGCGCAGCTTTTGGTCGAGGTATTGCGAGTCACCAAACGATTTTTTTGTAAAA
AGTTATGTCCAGAAAACCGAAGTGTTGTTTCTTATGTGGGCCAGAGAAGTAGAGCTGCACCCTATGTTCACCCCGGTAATGTTGATCTGTATTCGTACTT
AAAAGTATCATGTACAAAATTCAACATGTTATATAAGTCACAACTGTAATATTGTGGTTATATCTTATTTGCCGGGTATAGTAATTGTTCTAATTGGATA
AAAATGTGTAGAACGTTTCATATGATTGGTCGATGTAGGTGCATCTCATAAGCGAGTGCAGCTCTCAACATGCGAATTGCGGTAGCTCACAATAATGAAA
TTCACTTACACTAACATATGTGAAAACCGCACAAACAACCTCACGAAAAAAAAGTCTGAGTGAGACTAATTACCGTTGTAGTGACCAGAGGTTGGGTCGC
AAGGTCGGAGCGCGTCGTCAGAATCTATGAAACCATTGATGGGTCAGCAGCAGAACATAATAAACTACCTGTTTGTGTGTGGCGTTCTTGCCTTCCTGAT
CCAGCTTCAGGTGATCCGCATCCCGCCAGGACAGGGATATATAACCCGTTACAAAATAGGAAAACTATTAGGATTAAGGATACTACTAGTTCTTCCATTA
GTATTAAATGATGATAGTTGGTGATACATAGTACTGAAAATAATATTGTACTAATCTCGCTCGATGAGACGCAAAGCACTGTCGCGATTTGCAATACGGG
GGCGTGGCCACCGTGGTGTTCAAGGGAGGTGATATCGACAGCGGGCTTCCCGCTAACTGCAGCGGGGAGCGAGGCAAGGCGCAACAGTACTGACAAACGT
TGGTACAATGCTAACGTTCAATGAACGGCTTCAATACATGTAGCCTACCTGTAGCTAGCTATCTGGGGTGTAAGTATGCGGGGAGCTGGCTTGAGTCTTC
GCTATGAATAGTGGTAGGTTGTGTCTTGTTTTACTAAGTCCCACCACTAAGTTCCCCCTATTATTGGACCCGGGTAGCTTTGTTAATTAACGAATTTTAA
TTTAAAAAATGACCGAAGAATCCATCGAAATGGAAATTAGAGGGCCCTGCTCAAACTTAAAAACTGAAAGTAAACTACGCTTACTCAAACTTTAAGTACC
GAAAAAAATCTATTTAAGCAAGGCTTAATAAATAAAATATACAGTATAATAATAATTATCTCGAGCAAAAGACCCAATGACATTCGCAACATTTCAGCAA
ATGTCGTCAAAAATCAGTAAAACTCACGAAAGTATTCGCGCTCGTTGCTAATTTATTAGACAGTAGATTCGGCGTCGAAAAACTGCTGCAGTCACAAGAG
AATGAGAAAGAAAAAGTAATAAGCCAAAACGTATCGTAAAAACAAATTGTAAAGCTTTTTTAAAACACTTTAAAAGTGAGAACCGTTAACCATTATCTAC
ATGTATTAATACTTCTTCCTCTTTATTTTGTTTAGCAGACAGCAAAAAACTGGAATCAGAAGTCGTTCTGTTGACAGTTAACTCACGTTAGTTGTTAACA
GACCTCATGGTACATGCGCAACAGTCTCGCAGGTCCTAGTGAGATGGGTTAACCCATCTACAGACTCTCTCAAGGTACACTACGATTTAACGTTTGGGCG
AATTTTACGTGCCGTTCACAGTAAGTAGCAAAGCCCTCCACACCTCCAAACCAATAGCCTGGCAAGAAACTTCACACTGCCTCCGCCAGCTTCGTACAAC
ATGATGTACTACCGTTGATAGCATATCATTGCCTCTAACACTGGCGAAGTCCCGCTCAAGCGGACGGTAGCGCACGACAACAGCTGCAAGCTACATGCAG
TATATCTTGAAGATACCTCCACGCTGGTCCATGCTCAAAGGAGTTCCCACGCGAAGACATGTCGAGGCATGTCACCCAAGCTTTTGTTTGGACGCAGCAG
CCCTGCTTCTAAGCGCGCTTAAAAACTCTCTCCGCGATTGCTCATCGGTGGAGTGACTTGACCCCCTGCTGTTTTTGCAGTCTTCCTATGGAGTGTGGCC
CGCTGATCCTGCCTCGTCGTCCATAACACTGCCGGAGTCGACGTCTTCATCTCCAAAGCCGAACGATTGTTCGTAGAATGTGTCAATTTCGTGAGCTAGA
AGAAATTCTCGGATCTCGGCGCTCTGCAACTTTGCGATATTGTCAAAATTGGAAAACGAATGCTTTCCGGACGGCAACCATATTAACAAAAACTACATTT
CAGTAATAATAACATTTCTTATACATGTACGAACCAAATACCGTTCCATATTTTTGAGTCAAGGTGATGGGAGCGACTTCATTTCGCTAGTAGAGGTCGG
AGACTTCCTGTTCAGCTTCTTCCATTAGTCGTCATCACTACAACTTACAAACCGTTTAGGCAATGTAACTATCCTACGAAAGATAAAATCTGGATGGTCT
CTGCCGGCCTCGTGCGGAGATACCGGTACATCCATTGAACTCGAATCCATCACCGAAATCGACAGCACTTCTAGCATTTATGTAGCACTTTATCTTCTAC
GTGCTTTATAGCATAGTTTACATTTCCTGCTCGCTACTGAGCTATCAGTTTGAACCACAACATGGAAGTTCTTACTTAACCTAACTAACATTCAGCATCG
CAGTGAGCTGCAAGCTGCCCTGAGTTGATCGAGGCATCCATAGCAGCAGTGAGCCGCCACCTGTGCCTGGAAGGCCCAGGAATCCGGGCCTCCACCGATC
CAAGTACAGCGTCTTGCCTCCCAAAGCAGTCACATTCGACCTCCACGTCGCCGTTTTACCGGCCGGGACGTCCACTTCGTCGATCTTGTCACCGCCAGAC
TTGATATTCACCGTCACGTCTTCGGTATCGACACTCTTAAACGTGATCGTAACGCTGCCATCGCCAACTTTCGTCCACAAGCCCTCGCTCTTGTTGAAAG
CACGCTGAACGGTGGTCAGGCCCAGCGCCTTGCTCGCTGGTCCGTCGTCAATTTCACCGACGTATTCGGTCGGGCCACAAATGGACTGGAAGTACTCAGA
GATGACACCACCAACAGCCCACATATCCCAAATGGCGTAGAATCCCGCGGCCTTGTCAGCGACCTTAAACGCGTACTCCTCAGCTTTGAGAAACGTGCCG
TTGCTGCTCGTTCCTGAGGTGATCAGATCCTCGACGATACTCCCGAAGGTTTTCCGCAGCGTATCTCTCGTAGCGTAGGCTTTTTTCTCGTTGGACTGTG
CGATGAGCTCGTCCATGCAGTTGTTTGTCGCAATCGGGATGTCATTCAGCACGAGAGTCGACTTGCTCATAGCAACGCGAATGTCGTTCTCAGACATAGT
CGGGTTGTGCTTACGGAACTCTGCGATTGTCATCCACGTGCGATCCAGCAGTCGCTTCATGTCGTAGCCGCAAGTTGAATTGGATTCCAGCGAAGTCTTC
AAGTTGGTGATGTCGTTTTTACCGAGAGACTCGACCGACTCGTTCATTGAAACTTTTTTCAGGAAGTTGGTGAAGTTTCCCCAGCTCGAAACAATCTCGT
CGGGGTGCTTCATGACCTCCCTCAACGTCAACTCAGCAGTGGTGACGATTCTGTCAGCAAGCTTCACTTCCTCCGGAATCTTTTTCCCCATACAGTACCT
GACTGCCACCGGAATGTCGATGACGATGTTGTCCGTCTGATAGAGAATCGCCAGCAACTTTTCTTGCGAAGTCTGGGGGTCGGACACCTTAACGTAGCGG
ATGTATTTGACCAGCGACTTGGTCAAACCCAACCAGGCCTTGACACACTTGAAAGCTCTCTGGAATCCCTTCGCCAACTCCCAGAATTTGAAGAACACAC
CCATGGTAGTATAGGACATCATGGCCTGGATCACCGTGAAGGCTTTGGTCGCGACTTCCAGCCCACAATCATCGTTCCGGCGGATGCACTCCATTCCACA
CTTGACGGGGTACGAGTAAGGGCATTGAGCCCAGCACATTCCGAGCTTGTAATCGTACCCGATAGGGCAGTTCTTCGTGATGTGGGTCTTGCGGTAGCAC
GCCGAGGAAAATGAAATGTCGATGTCGCCCTCCAACCCCACCCAGTTCGGGTAAGTGGGTTTGATCGTGCTGGTTGCGTTGACGACGCTGCCAATCGCGA
ACTGAGCGGCCGTGGAGCCCGAAGATGCAGTTGAGCCACTGATGGTCCCAGCTTTGCTGTCAATGCTGTCGGACGATTCGTCGAGGTCACTTGTCCCGCC
ATCTCGATCGTCGTCACTCGATGCATCGGTTGAAAGCTCAGTTTGGAGTACGCTGTGTACAGAGTCCTCACTATCCGGAGAGTCCTCACTGTCCACAGAT
TCATCGTCGACGCTTGAAGATGAAGCTCTCTTTAGTCCATGTACTCCTGCGGTCGTGAAGTTGTCGTCCGAGTCGGCGTCAGCGGGCGCCACCGTAGCAA
GCGGGTTGGACGTTCTGGGCCATCCACCAAATGTCAGGATCTTGGCCGAGGAGAGCCCAGCGAAGATGGCTACGAAGACGGCAAACAGTACAGCAAGCCT
GGACATCCTGCCGAGTCTCGCTCGCGAGCGCGAGGAAGCTTGTTGAGCCTCGAGAGGGGCGAAACGGAGAGTGAGAGCGAGCGGAACCCTGCTCCCGATA
CTTTCTTTGTTGCGAGAGCTGGCTGCTGGCCCGGCTTGGATGGACTTCCTTGCTCAGCTACCACGGTACAGAATCTTGAGCTTGTCAGCGTTGTAAGCAA
CAACGGGGTCGGTAGGATAGGCTCCGATTTCACCAGATAAGCATGCTTACCGTGTTGTAAATCAATTCCGGTGGACGTGTCCACCAGTGTACAAGCGGTA
CAACATTGCACGGCTTCAACAATACCACGGCAAACCCTCCAATCATCTTGGTGCAATTTCGGAGACACTTGGCCGTTTGTGCTCGTCGCTGGCAAGCACT
GCTCCGTTCTCGAGCTTCTGTGCAGCCATCTGTGGGAGCAACTAAAAATGTGCAGACGCACACGCCGTGCTCGTCACAAAGCCCCTCCTCCAACCACCTG
CTGCTTGCTTGAAATATCTCGTCGCTGGAGCTCAGCGAGCGGCTCCGCATGGTGTGACGTGGAGACACAAGATGCAGAAGGGGATCGGCGCTGGCCGTTC
TCAACTAACGATGATGTGCAGAGCGCGGTGCGGAGATTCGCTCGTGATGTTGCGAAGCGCAGCCACCAGTGCTTTTTGCGACTGCTGCAAAGCGCCGTGG
TTTAATTGTGAGCTTCGTTGACGATTTGCATCGACCTTTCCGCTGTTCGATAGCCAGCTCGGCTCGGCTCCCGAAGTAGACGAGCGAGCGGTCGTCGGTC
TGCAACTTGAGTGAGATCCATGGGCTGCCGGAAACGTTCCGCCAGTGGTAGTCCACCACCTCGTGTACGAAGCTGCGGTGTCGTGTACGAGGGCGGTGGT
ACACTCAAGCAGCATCGGCAAAGTTCGGTTCATGTAGACTTACGGTAGCTCGCTTGCTGCCTTCATGTAAGACCGATCACGTGGACGCAACCTCTTTCCG
TTGTGACAACCCCTTACTTACCCAGCACGGCGAGCGGTAGGCACGGGGCTTCTGTCTGTATTCCTGCGCACTGCAACTTGCAGTCGAGCGCGCGGATTAA
GAGGAGGGGCATCGGCTCCTACGAGCACTGGACACCGTCCGGTGGACAGCATTGGACTGTAGGTACTCCGCATTAGCCATTTTGAAAGGCTGCCCGGCTT
GATCTGCCACAAGGCACAAGTATAATGCATTCGATCGGTTAGCTATTACAGCTAAGTGTGCTTACAACTGGAGCTCATCAATACTCAACTCTGCGTGATT
TACAAGTGTAACAACAAAAATCACAATGGCTTGTCAGCAATTGTGCCCTCAAAGTGTATAAAAGTTGAAGCCCAACGCTGTGCCTCCCTCGCTCAACCCA
TGGAGAGACTTCTAAGGTCGCTGTCATTAATTATTCAGCACAACTGGTCTGTTTGCTGACGACGTTAGAGGTTCGTGCGAATAATGCCGCCAAAAAATCA
AAATGGAAAACCTTACTAGTACAGCTTTCATCGACAAATAAGACACTTCATATGCGTTGCGAATACATTATTCAGTAAACTTGCGGAGCTTCGCCTAGCA
ACGCTACGATTCAGTGGTTCCGTAGTGCAAATGTGTTAACACAACACCACACTATGAGCCGATACATGTACCGGTACAGGCACTGTAGCTGATACCGCAC
TGCAACCTGACAAGTGACGCCATGCATAAATCAGTTTTATTGGAGCATTTTATAAATACTTTGAAAATTAAATTTGGATAAGGGACACAAAATATATTGA
TTTGTGGTTACGTATTTTATTGGTTATAATTATTTATTTTTATTAATAGTATTCTGTTTTATTATAACTGAGCGCATTTTTTATTGCGACCCACACATAA
TTTCGATTGCACTAGTTAACAGTCGCAAAAAGTCTGTCTTAGTGGATGATGCTCAGTCTTGCAAAAGTTCTACTTTAAACCAAGTTCAGGTATATTTTCT
ATAGATTTGTGTATTATCTAAAATAGTGGATGTAGGGCACACTACAAGAGTCTATTCGAATAAATATCTGTCTCGGAACAAATCACAGCTCTGCCTCATG
CCGTAGGCTTGTAAGGATTGTGAAAACACATCCAGCCTCATCCAGCCTCCTAAACATATATAATTTGAAAGGATTTGTCCATCAGTTGTGTGACCATTTA
CTTCTTCTGGAGGTCGACAGCATGCGCGACGCTATCAAACCCCAGGTTTTTCATGATAACGAATTCAACACAAACGACTAGAACATGCCGACTGGGCTCC
AGGCTTGAATAATTTCGAGTGACTGCACTAACATTTAGCGAACTACACCATTTCCCAGGCAGACTGGTTGGTTTCTCAACCAAAGTGGTTCAAATCATTT
TTCGAGAAAAACCTCATATCACTTTTCCCAGGTATTTTCAAGCAAAGTGGTTCTGTCGTAAATCGTTCCCAAGCAATGTGGTTTCACAATCATCGAGGAT
TTAGAGCCATTTTGAAGAAGCCAAAACGTAGCTTAGAACAGCCTTGTGAATGTATTTGAGGGGTCTATCGTGATCTACGTGACGTGGGCATTCTAACTAA
GCTTTTTTGCGTCGAAAATTAGCAATTTTTGATTCTTTCAGACCAAGCCCAAGACGTGGACTGGTCCGTTTTAGCCCCATATGGTTGGGCAAACCATTTT
GCTTGGGAAACAAACAGCTATAAACCACTTTGCTTGAAAAATGCCCCTTTTCGTCGCAGTATTATGTTGCGCGAGACCTTCCCGCACCACTTTGCTTGAA
AAACGGTCAGTTTGCTTGGAAAAAGGTGTATTGTATTATATATGGATTAGAATGCGTATCACTAAGTTCAGCCGGAGATTTTGCGAAATAGTTCATATTT
ATTTCGTTTTTCTGGCATGTGCTGATGCTCAGTTGCACTGAAGGTGACTGAGTTAGAGTCGAAAATATCACTGTTTAGAATAATTATGTCGAAATATTGC
AATAACTCAAGTGTTCGCAACAGCCAGAATTGTCCAGGAAATAGCAAGTTGCACAGTAATAACTCGCAAATATTTCACGTTTTCAGCCGGTGGTCTACTG
GTTATCTCGAAAAGTATTCTATCATTTTGTTTTGCGTGGTCTCATATTATGAGACCACGCAAAACATGTGGGCATATTATGTCCACGATTTTGCGGGTCT
TTTCGTATCATGAACATTTCGGCAATCCGGATACTTCCGCCACCGCGAATGAAAGGATCAATTATTGTGGCTTTCATCCGTTTTGGCAAATCGGGTGGTC
CAAGATCCGATATATCGGGCCCGATTTGCTGGAGGGCTCCGATTTAGCAGGAGGGGCTGAGGGAAGCAAACTATATCTGGCCCGATTTGCGTCTGGGGGC
TGCGAGTTGCGAAGCAGGGGCCAGAAATGCCGCTTTTCGCCGGCAAAAGGGAAAACATGTCTGGGGCCCTCTCAGATCGGCGTGGCACGAGGTTGTAGCG
GCCGTAGATGATCACACAGGTGATTTAGCTGGCCATAGTGCTACGAAGTGGCTATATACAGTGTACTATTGTCCCCAATGTCTTGCAGTTCTAATGCGTC
ATGAGAGGTGAGGAGAACTTGGAATGCCTCCCCTCTGAGCCTTATGCTACTAACTCAGGTCAGATATAGCTAAATTGGACTAACCGATCATGTAGGAGCT
CCATTTTATATAAATCGGACTCCGAGATAACACGACAAATCGGGCGGCAAAATAGTTGAAAGCCACAATACCTGGAAGTTATGTAAAAGGAGGGCGTCTA
CCCACACACTGTTGTATGTGAGATGTAAGCTTACCGGTACCAAGAAGGCACTAAGAAGGCATTTGAGTATGTTAGAGCATCTCCTACGGTAGTGCAAAAC
TCAAGGAATTGCACGATATTTGCAAAATTGCAAAAAAATCATCCCCAACGGGGAAGTGATAGGGGTTCAGAAGTAGTGCTGAAGTAACACGTTGAAATCG
ATAGTGCAATTCCCGGATGGCGTAGTGATTATCGGCCTGCTATTCACTACGACCTGCCAGCTATTGCACGCAAAGTGCAAGGCGAGAATACGCATTTATG
GACGCCTTCAGCGCGTGCACCCGTCCGAAAGAGGTACACAACGCTCTCACAATACATATACTACTAGTTTCATAGGTACACCGGATGAATAGAAGCTACC
GGGCTTACCGGCAGTTGCTACAGTATGTAGGGCAAATGACTTGCTGTCCCAAATGCATGCTGCAAACAACGGCGGGCCGTTATCGACCTGAAGTGCTCTA
TAGTTGCCTAGTGCTGCCTATTGTGGTGCCTTTGCCGCGGATAACTTAAGCTACGCTACCCTTTATCGGCCATTGCGGAGGGAGGGCTACCCGCTTTCAC
TACGCAATTTTGCAATACCGTTGGGGAAGCTGAACTATTGCAAAAAAATTCAAGCGTGTTCGTCTTGTTTATGTTGCTAATCGGTCATTCACTTTGCCTT
ATCACTTTTGCAATTTGCACTACCGTTGGAGATGCTCTTGGTATGTTCAAACTTTTCGGAATTGGATCACTGTTTGACTGATGTCTAAATACTGTACCTA
TGTTTTCTATTTATTCGTACACATCCTGCATATTTTCTACAAATTCAAAATGTCCGGTAAGTTACACTTAAGTCATTGAAATTACTTCACTACACCTAAC
TCACATTTAACATCGCAGTGAGCTCCAAGCTTCCACCTTGGGTAGATCGAGGAACCCATAACAACAACGAACCACCCCCAGTGCCAGGAAGACCAAGAAA
TCCGGGCCGCCAACGATCCAGATACAGCGTCTTACCCGCCAGCGCCGTCACATTTGACTTCCACGTCACCGTTTTTCCTGCTGGAACGTCCACTTCGTCT
ATTTTGTCACCACCAGACTTGATATTCACAGTCACCGCTTCGGTATCGACACTTTTGAAAGTAATACGCACAGACCCATCGCCAACTTTCGTCCACGAGC
CGACACTGTTGTTAAACGCACGCTGCACGATCGACATTCCCAGCGCCTTTTCAGCATCGCCGTCGTCGATTTCCCCGATGAACTCGGTGGGCCCGCAGAT
CGGTTGGAAAAACTCGGAAAGCGCGCCAGTGAAAGACCACGGATCCCAAATCGAGTAGAACGAAAACGCTTTGTCGGCAATTTTGAAAGCATACTCGCCG
GCGCTGAGATACGTCCCATTGCTGCTGGTTCCCGAGCTGATGAGATCGTCCACGATGCCTCCAAATGTTTTTCGGAGCGTATCGCGAGTGGCAAAAGCCG
TTTTCTCGTCCGATTGAGCGATCAACTCACTCATGCAGTTGTTTGTCGCGATGGGGATGTCGTTCAGCACGAGATTCGACTTACTTATAGCGACGCGAAT
GTCGTCCTCGGACATTTTCGGGTTGTGTTTGCGAAACTCTGCGATGGTCATCCACGTGCGATCCAGCAGTCTCTTCATGTCGTACCCGCAGGTGGAGTTT
GACTTCAGCGCTGACTTCAATGACTTGATATCGGTCTCTTTCAGCGACGTGATGGACTCTCCAAGCGTGATATTCTTCATGAAGCTGGTAAACTTGTCCC
AACTAGAAACGATCGTCGCGCCATTCGCGATGACTTCCTTCAGCACATATTCGGCAGTCATTAGCACACTATCCGCGAGCTTGAGCTCGTCCGACGCGTA
GCTCCCGATGCAGTAGAAGACAGCGATGGGGATGTCGACAACAACGTTGTCAGTCTGGTACAGAATCGCCAAAAGTTTGTCTTGAGACGTCTGCGGATCA
GTCACTTGGATGTTACGAACATACTTGGCCAGCGACTTGATCAAACCCATCATATACTTGGCACACTTGATAACCACTTGCACACCTCTCGCCAACGCCG
CCAGCTTGCCAAATACATCGTACGTGATGAGAGATAGAGTCGTTTGCGCCAAAGCCGACACTTTAGTGACGATCTCAAGCCCACAGTCGTCGTTTTGTCG
AATGCACTCCAGGCCACACTCGACTGGGTACGCGTACGGACACTGCGCCCAGCATGTTCCAAGCTTGTCTTTGAACCCCAATGGACACTCCTTGGCGATG
TGTGCTTCTCGATAACACGCGGTAGCGAAGGAAGTGTCGAGAGCGGAGCCTACCCAGTTCGCGTACGTGGGCCGAATCGTGCTGGTGGCATTGATCACGC
TGCCTATCGATAGCGCTGCTTCCACAGACTTCGATAAAGCGGCATGGCTGTCGTCGGATGAGTCATCTACGCTGTCTGAAGAGTCGAGTGAAGGCGAGTT
ATGCCTGGCGCTGGGCCCTGAGCTGTCGTCGTCACTGTCCAAGGAGTCTAGAGAGTCGTCGTCACTGCTTGGAGGCCTTAAAGACGACGTCACAGTCGCT
GCTGGTGTGTCATTCGCGGCCATATTGATCCTTGCGGACACCGTTGCGACTGGCGCTAGTCGAGGCGGCGCCATCGAGACCTTGCTGAACGTGTACGTGC
TCGCAGAGGAATCAGTTGCTGCACACGCTGCCGCGAAGACGGCGAACACTGCAATCCATCGGACGGTCATGACTGTGTAGAACACGGCAAAACGAAAAGT
GAGCTGGGTCGACTACATGCACTGCACCGTCAGCAAAGGTCTTTCTTTGCGAGCATTGGGCTCGGAGTTTAAACTCTAATGTCCTCGATATATTATCGCG
TGCGTGGCAACAGATCATCGGGACGCGCTTCTTCCAATCGCGGGTGGCTTCAGCTTGAA