Description :
From Genome Similarity Track
Location :
Scaffold_35:9386- 12350
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_35-fgenesh-gene-0.12Ankyrin repeat domain-containing protein
Pytiw_DAOMBR242034maker-piw_contig_35-fgenesh-gene-0.13Aspartyl protease family A01B

Sequence
2964 bases(100 bases per row)
TCGCAGTGCGAGCGTGTTTGCAAACACGACCAGGCGGCACTTCTCGCGCTGGTCAATGGGGAAGCGCGCGTGCAGCAGCGGACTCCAGCGCACAGACCAC
TGCGGCGAGAGCAGGCGCTTGACGTCCGCCCACATCCACGACGACGCGAGCGCGTCCGCCATGTGCGCATGCGCTGTACAGACCAGCACACGTTCAGTTA
GACTAGCCATTAAAACGCAGTATGTATAGAGAGAGGCGCGCTTACAGATCGTGTAGCGTGACGCGCCATGTGTCAACAGGAGCTTGATCATCGTGTTGTG
CCTGCGCTTGAGCGCCATCACGAGCGCCGACGTGCCGATCCTGTGCGTACACACCAGCCAGCAGCATCAGCACGACGCGGTTACCAATAAACAGTACGCA
TACACAGAGCACACTCACGCAGTCGTCGCGTTTAAATCGATGCTCGGGTGCGCCACGAGCCGCTGCGCGACGTGCACGTGGCTCCGCGATGCCGCGTAGA
GCAGCGCCGTCCAGCCCTCGCCGTGCACGACGTTCACGTTGCCGCATGGCTCGATGGCGAGCCACGCGTCCACTGCGTCCACGTCGCCGTTCGAGGCGGC
GTCCAGGAACTCGCGTGTGGTCATCGGCACGTCGCCAGCAGACATCCATGCCGCCATTCCCGGTTAATTTAAGAGCCAATTTTAGTGACATGCAGCAATT
TTGGCTCAGAAAAATAATAGCAATTGCGAATAAGGGAGTCACTAAAGTGAGTTGAAACGCAACCTTCCTGGGCACAACGAAGTGCTCATCAGATACATCA
CCAGCTCGCGCCTTGTTCATTTTTTTGATACAAAAATCTCTCTCTCCTTGTCTGAGACCCCACCATTTGACCCTCCATATCTACACGCCACACGTCCATT
CCCCCAGCCTCCCAGTCTCTCAGTTTCTCTACACCACGCTGTCCAGGTTTTCGGGTTTTCCATTCGCAACATTGTCGTCGTCGTCGTCGTCATTGTTGTC
CTCGTCGTCTGCAAAATTGCGCTCGTCCTCGCCGTCGCTGCCTATTGTGAAGCGCGGCGCGGGCGCTTTCCGCCGCGAATGTGGTGAGCGCACAGCCGTG
GTGCTGGTCGCCGAGTCTGGCGGCAGCTCGATCTCGTCGTCGTCGTCGTCCATGTCGTCGTCGTTGTCCGTGTTGAAGTCCTCCTCTTTCGGCGTGCCCA
GCGTCGAGTCACCCGGGATCGCGTACCACGAGCGCTGCTTGCGACGCCAGACGGCGGCAAGCAGCACGAGCCCGACCAGCGACACCACCATGATCTGCGC
CATGAACGCGCCGTAGTGGAGCGAGTCGACAGGGTTGTCGCTCTCAGTCTCCATGGCGGTCGTGGTGGCTAAGCTCGTGTTCGCCGCGGGGGCCACGCCA
ATCGCTCCGGGGCTAAGTGGGATCGGCTTGCCTCTCTTGGCATCTGAGGGTCCAGACAAAGAAGAAGTAACGTGGAAATGAGCTTTCACACTTGAGGTAG
ACAAAATAACGAAGCGAGTCAGTCACAGACAACGAACGTACCGCAATTGGATTCCGCGAACCCGACGCGCTTGCTGTTGACGTCAAAGACCACGTCGTAG
CCCACCATCGTGCTGGCTCCGAGCACTACATAACACCAGACATTCACACAATTTTGGTTAGAACACTTTCATCAAAAACATAAGAGTGATGCTGCTGGGT
ACGTACCGCCTCCGCTGCGCTCGGTAAAGTGGATGTTGCCGTAGTAGTACGCTCCGTCGTCCGAGAGCGTCAGGTACTTCTGCGGCGGGATATTGAGTTC
GATGGCTTCGTCGCCCTCTTTCATGCCTTCGAGCACGACCGTGATGTTCGGCAGCGACTTCAGGTCCTTGGTGCTACTCAGGCTCATGCGCTTCTCACTG
TACTCGATCCCAGCCGCGCTCTCAAACTCGCGCATGAATGCACGCGAGCCGCTTGAGACGAAGAACGTGTCGGTCGTGCCGCTGTCAACGATCACGCCCT
TGCCACTGTTGAGCTCCGACGGTTGGATGCCGAGCGTCTTGCCGCCGACCCAGATGTCTTTCACCTTCACGGGGTAAAACCCGGAATTGTCGGCGACCAA
CGGCGTGTAGGACACGTCCGTCTTGTGGTGCGTGTAGTCCACACCGCCGAGCACGAGGCTGCCGCCACGCTCGCCAAAGCAGAGCGAGAACACGTTTTTC
TCCACTCGTTTCGCGTCAACCATGTACGACAGGACGGTCGCCTTGTCGCGCCCGAGTCCCATGATGCCGTTTTCCTTCTGCGTGATGAACAGTCCGGTCT
CGCGCGTCTGGCAGCCCAGCGGAAAGCGCACGCCGTAGTGGTGCATGATGAAATCCGTGTCAGTGCCAGAGAACCCTCCGACCCACACGAGCTCGTTCAC
GACTACTGCCTGCCACATGCTGCCTTCCGTGTAGCTCTGTGACAAAAAAAATAATCATGGAAAGTAGAAATTGTCAGAGATGACTCGACCATTTTCCCAA
ATCAATGGAGCTGCTCGTATGAAGAGCTCCATGGATGGACCTACCTGGCTGATGTAGCAGCGGTCTTCGCTGCACGAGTTGCACGCCGAGAACTCTTTGC
ACGTGGAGAATTTGGCGGTCGTGGACTTGGTCATGTCGAAGTACTCGTCCGTGTGCACGCCGCAGTCTTTGCATCTATAAAAAAATTAATAAAAACGGTG
TCTCAAAGACGCAGCCCATAACGCCAGCAGACTAATCGTGAGGATGAACGTACGAAGAGCACGGGAGCGCGGTCAAGTGGCTGCCCGTGTCCACGATCAC
GGACGCGCGCTGCGCTGGGATCCCCAGGTAGAGCTCAGCATAGTGCGTCCTATCCTCATAAAACATATAATATAAACATCACATCAGCACTCCCCCATAC
AGCGCTTCACGAGCATCATCATAATACACACGCACCCAAAGCCGACGCCGAGCGGCACCTTGCT