Description :
From Genome Similarity Track
Location :
Scaffold_207:93846- 96502
Sequence
2656 bases(100 bases per row)
ACCACTTCCCTGCCGAATATCCTTCGCTGAAAGTTTTACCTTGTAAGATTCGTCGGATAGATAGCAAATATTGTTCTTACTCGATAGTGATACCATATCA
TCACCTGGCCATTCATCTTTGAACAAACCAGGCGTACGGCGATCAGACTAAGCTACCTCAGTGTTGTAGTCGCGTGGGAACAGCTCGTATTTGTGCTCCT
TAAAATGGGATCGTAGCCCAGGATTGATACAGGCTTGAAACGGATTCGCAGCTGAAAGCGATATAAGCGGAATTAGTGTCCATCTCCTGATACTGGAAGT
CAGAGCGATCGAAGTAGAGATCTATGCAGTCATAGTAAAACTAAAGGATGCGTTGCTTAGCGAGCTGATAGATAGCAATAGACAAATGGATTGGGTTCTT
GTTATTGAGTCGATGCTTCTTCGTCGTGATTTCACACGCATCATTAAGCTCCTCGAGACCATGGAACGTAAAGGGTTCGATCCTGTTCTTAATATCTTTG
TCGATCGACTCATACTTAACCTATTTGTGCTTGCTCATGTCCATTCCAGATCCAGATGCACTGTTGCCTACCAGTTTCATCATCGCAGCAATCATCGCCT
TCGACTTGTCAACATAGCCCTCTCGTCGAGCATTTGATACAGCCTCCATAAAGGGGGCAAAAGCCTTGTGAGAGCTGGCCTTGACAAAACAGTAAGTCTT
GGTTATCTTCATACCATGAGAAAGGTACCCCTTGAGCAACGGAGTGTAGATGAGAATCTTTCACCAAATTAGCTACCAATCAACTTGCGAGCTGGTTTTG
CTCGGGATTGCTTGCGCGCCTCATTGTGATCGAACATGTGCTTACCAATGACGCTCTCATTCGTACAGTCGATCAGTACATTCTTAAAAATTGGAGTCAT
CTCACCAAAGTACTGGGTGAGGTGTTCTGGTGCTCGAATATCACACTAAAGAAAGCCGAATACCTTGGTTGCTTTGACGTCATCGATGATACCATCATAC
GCTTCAACCGTAGTCAATCGACCACATGGCATCTCATTACCAAGGGCCCATAGGTATAGAGCGTTAGCATCGTATCCGATAACTTTCTTACAGACCTTAC
CACCGCGAATCTTCGTTTCATTACGCTTAGCGTAGCGATTGAAGATAATAGATGGACCTCCAGCAATGTTGGCCTTCGTCTTAGAGTAGATATCCTTCTC
CTCCTTGTCGATCGCGTATACCAGTCTATCCGAGTTGAACTCAAGCAACTTCTTAAACCGAAACCTCTTAAGCGACATGTCTTTTCGAGCGGTGTTGCAC
TTAACGCAGCTGACCAAGATATTACCGTCGATGTGGCCAACATTAATGTTGATACGATCCGCTGAAGCGGTATCAGCAATCAGCTGACAGTTGCATAGAT
CACACAGATACTTTTGCTTTTGCAGCAATGTATTCACGTGCTCGAGTGTCATACCGAAATTTCGTTTTGCCTTAGCATCCTGACTCTTGTAGCCAGACAT
GCGCTTAGCTGGAAATTGGAATGCGTTAGCAGGTTTCTTATCCGGATAATGGAGATTATAGAAGCAGGTCGGATACATGTCCTTCTCTGAAATACCAGGT
AGAGACACTCCATCTGCAAACACATCCAGATCAAAGTGCTTAAATAGCTTTCGCTAAGCCTTGATATCGAAGCGCTTAAATAGCCCTCGCTGAGCCTTGA
TAGCTTTGGTGAAAGAGACTACGTCGAGATTATTGTACCAGATCAGTAGGACTTTGATCGATTTCATCTCGTAGTAATCCTACACGAATTTCACTCGTTC
GTAGTCATCGCTGGCGATGCTTGTTTCGCGGAGCTTGCTATCAAAAGCTGACATAGGCGGGATAGCCGTCTGGTTTAGTACATTGAACGCGGTGATGTAC
TCGTAAGGGAAAATACCCCTACCATGACCACGGGCACATCTAATTTTGTCATCGCATTTGCAGCCACCGAGATATGTTGTAAGATTCTTTTTGTAGCTGG
TACCAGCTGGTACATAGTTAGTGATATCAATCATTTTCATGTCCGCTGTAGCAATGCACATGTAGCTGGGGGTTCTGATGACAGAATTTTGGTTGTCGAT
ACCAATTACGGAGAACAAATCCTTGTTAATCAAGTTAATGTCGTATCGACCAGAATTGAAGCCGAATACTGGTACCAGGTCAAGTTGCTGTTTCAGTTTC
CCATAATCAGACCTTTGCTTACCAAAACCAAGACTGATATGGAAGTGGAAGAATTTATCATACTTCCCTCCCTAATCCAGCTCTCCACATCAGTCATCTT
GTACTTTTTATCAGAATTACCGCATGGGACTTCCATACCTGTCAGACTATGTGCATTGATGATTTTCTGCAGAAGCGACTTATACTATCGACATTGTACT
GTTGGATCTTCACCGATACATATTTGAACATTTTCATAAGCAAAATCCTGGGGTCGTCATTTACAAAGCAGCGCACCCCCTCGGTTAAGCTATCAACTAC
TGATACCGACACATGAATGTGTTCGTTCGTAAACACACTATCCGCCCCGTGTTGAGCCGCGGTAGGTTTAAGAATGGCCTCAAAGTCATAAACGCTGAAG
TGATCGATGTAATGGTCAGCATTCTTGACGGAATACTTCGTAAGCAGCGATCGCAT