Description :
From Genome Similarity Track
Location :
Scaffold_437:938450- 950206
Transcript NameFunction/comments
Aphin_H310_05965Hypothetical protein
Aphin_H310_05966Hypothetical protein
Aphin_H310_05967conserved unknown protein

Sequence
11756 bases(100 bases per row)
GTCGTCCCGTTCCTGTGCCATCGTCGGAATCTGACTGTTCCTTGCAGGGGTGGCCACTCTCATCCATGACATCCATTGCATCCATGTCGCTCGCGTCGAT
ATCCCTGGAGCGCGACCGGGGCAAATTCACACTGGTGATGCGCATCCCCAAGAAGTATCCCCATGCAGCTCCAGACATTTCGTGCGTCACTGGCGGCGAA
GTACGTTCTCCGTTATTTCGTTCAAGGCAATTCTCATGTCACGTCGTGGTAGTACATTCCACCACAACTCAAGCAAGGCCCTACCTTTGTGATGCCCTGG
ATCCAACAAGGGTGGCCGTCAACGTATTCACTTTTGCATTTTGCAGAGGACTTGTGCACGGCCCTCGGCGCCCCCGAAAACATTTCCACGACCAGCTTTC
TCTCTGAGCAGAAGGTGTTTCCTCTGGATTCGAGTCACATTGGGTCACGAACATCGCAGCGAGTCCTTGACCATTCCAGTACGACTGCCATATTTGCCAG
TAGTGCCACACACGTCGAGAGAGAGGCTGATATCCGCTTACAGAGGCATCGTGTGGCAGCAACGAACATGCGACGGACTTGCTCATGTTGCACGACGAGC
CGGCAAAGCCGTCGCCATTTCAAGGAGGGACGGCAAAGTTGGCCACAGCGACACCAACACCCACAAATCCGTTTGATTCTGGGCCACACACCTCCGTGAC
GAACGTAACAGCGTTGAATCAAAGCAATGGCGGGGATGTGTCAGGCAGCGCAAAGCGAGGGTCGCCGCACCCAACCCACGATCTGTTGGGCATGCACCAC
CAGCTAACTCCAAGTGCCCATGGGCATTCCAATGGCGCACCCGTAGTGGATTTGCTAGGGATCGATTTGGGAATCCAGCCATCACCACCTCGAGCCATGC
AAAGAAGCAACGACCGTAGCGGGGACAGCGGCCATCTGGCGATTCAAACGACTACTCTTGGCAACACCAGTCCCCAGGGGAACGTCCAGTCCCCCCGTGG
GCTCGAAATGCGATATCAAAGCAACGAGTGCTGCATCAAATGCAAATTCAAGGATGAAGCGCGGCGGTTTGTCTTCGAGAAAACGATGACGTTCCAGCAA
CTGCAGGACGCGATCGTTCGTCTTTTTCAGTTTCCCCCGGCAACTATCGTAACCTTGGCATATTTGGACAGGTGCGTGGATGACTGCGGGCTTACCGCTC
ACAAACTCGTGTTCTGAATGCAGTGACGGCGACAAGTGCGGCCTGTCGTCGGACGAGGTATGGCGTGCTTTGTATTAACTAATACTGAACAAGGCGCAAC
ACAGGAACTTCGCGCAGCGCTCTCTCACTACCCCGACACATTGATTCTTCAAGCCGACATCAAGCCCGGCGAGCACTCAAAGAAGGCCGAATCTCTGCCA
CCGTCACCGCTTCTCCCTGCCCGTAACGATTATATCGGCATTAGAACCCATGCATGCGCCACGTTGCTCATGGTGATTTGCTTGCATGTGTAGAACCCAA
GGCGGAAGACTCGATTCTTCGAGAAATCAAGATCGAGGTTCGATCAACTTTGATGGATAGCGATGCCCGTGACCATGTCGTTGTTTGGTAGGATGTCAAG
CTGGAAAAGTGCATCGGAGTCGGATCGAGGTCTGCGGTCGTGGTATGCAACGAGTTACTCATAGACTTGCGTCGATGTGTAGCTGCAAAGTGTACAAAGC
AATCTGGCGAGGCACAGAAGTCGCCATTAAAAAGTACGCCGCGGGTAAACGTAAAGGACATGGACTAATGTCACGATGACCAGGTTCACGTCCCAAAATG
CTGATACTGTGAACAAAGAGTTCAGGCATGAAGTCCAAATGATGGCGCACTTGGGCTGCCATCCGTGCATTGTGCTGCTTTTGGCCGTATGCTCAACCCC
CAAAAGCATTGTGTTCGAGTACCTTCCGTTTTCACTTTTGTACGTCACGGCATAACTCGCACGGCACGTTGTGATGGATGTCGTCGGTAGCGAGCAAATC
AATGGCTCCCAGGACCCGTCCAAGAAAATACCGCCGTTCCCAAACACGTGGCAAAAGCGCCTACAGATGATTGTAAGCACATTGTGCGGTCGCTGGCGTC
TCAGTAGTAGTCGCGTTGTAGATGGACGTGGCGCGGGGGCTCCAGTTCCTACACTCGTTCAATATCGTGCACCGCGACCTCAAGTCTCTGTAAGACTGCG
CTGAATGGCGAGTCTTCTGGTCTGAGAGAGTTTTAGAAACCTGCTCATCACAGACGAAGGCCGCGTCAAACTTGCAGGTGCGTATATCACCGTTCGCTGT
CGCTATGGGATGTCGTTCGTCACGCGTGACCATCTAGATTTTGGCATTGCTAAGCTAGCCCAGGACGAGTTCATGACTCGATGCTGCGGCACGTACCAGT
GGATGGCTCCGTATGCTAGCAATGATGTCGCCCACTTGCCGAGCTTACGTGGCGTGATGTTGTAGGGAGGTCATCGTGAGCCAGTCGTACTCTGTGAGTG
CGGACATTTACAGCTTTGGCGTTGTCATGTGGGAAATATGCGAAGCGTCCGTGCCGTTTGCCGACACGCCTGCGGCCCTGGTCGCCATGGCAGTCATCCA
GGAGAACAAGCGACCTACCATCTCGCCCAACATCCCAACGGTACGTCGCTCCTCCAACGTTGTACGAAGAAGATGCCACGCCCTATTTCTCGATCACTTC
TTAACAATTCCGTGGCGCCGTAGCCGTTGAAGGAACTCATCTCAAAGTGCTGGCACAAAGAAGCAACCGTGCGCCCTGATGCGGCCACAATTGTGAACGA
CCTGACCAAGTTTCTTCAAGCTAGCCAAACACCGACGTAATCGACACTTGCATGCCACATGAGGTCAACGCTTTCGTCATGATGACTCAACAGCGATGGA
TGCACTCAAGAACTCGCTCGGAGATGGCGCGGAAGCTGCGTTAAATAAGAATATTGGCGGTGTCGAATGGCGTGGTCTGTATATTCGACCAAGCCAGATG
CGCACACGACGTTGCCATCAACGTTCAAGTCGCGGACGCCTCGTCGCTCGAGGTTTGGTTCGGTGAACTCCATGGCTTTACACGCGGGGACGCGAATGCT
TTTTTCAGGTCCTGGACACGCCTTCCATAGAGCGACGTTGAAGGGCTAAAGGGTGCAGGTACAATGTGAATCTGGCCCAGCAATCGTCTAGCGCACTTAG
ATGACACAACGCATACCGAAGGAGAACGCTTGGCTGGGGGGCGATCGAGGGACATCCCAAGTGAGGTTGCTGCAACTTCCGGAGAAGCGTCTCGACTGTG
ATGGGCAGAATGACGCCAGTTTCCTCTGGGTCCATAGCTCGCACGAGCAGTGTAATCTGCGTAGCAGGCGCCATCCAAACTCAGGATCTCTATCGACGAC
GGCAGTGCGATGACGTACGTCGTGCTGTGTCCACCCGAGGTCCATGTGAAACAAGATCGAGCGCAGCTTGGACACACATACGGATCCATCACCCGCGCGG
TCGGCCTGGCCGAATAATTCGAGCACAGATATGCGGTGCTCCGTCAAGTAGAGCTGCAGAGTCAAGAGCAGCTACCGACGCAACGAAGGGGGGGGTAAGC
TATGGTTGAAACCATAGCAACAACAACGTGGACCACCCTACCACGTTGATGTGGTTGGTGGGCATGATTTGAGTGCGGGGGCTTTTCGACGGCGCAGACC
GAATCGACCGAACAGATCGAATCCCGACTTTATCGTTGTGAATGTCTTCGTCGCGATACCTATCAGCAGAGCGTTGCCGTCAAACGCGTGGCTCCACAGT
TGAGAGAGATAATCTAGTCGTACGCATGAATGGCATGCAAGCGGCGCTTGGCTTCGTCGTGGATCGGTCCATCAATTTGTCGCTATTGAGGCGGCGGTCG
GTTGAATTTGAGGCGAAGATGCACGCACCGGGATGCCAAACCCATCCTTGAGCGGACCGTTGAACAGGTTGTGTTTGGCAGGGGTCGGCGGCAATCGATT
CTTCTGAACGTTGTCGATGCTCTGTCGCTTCTGCGAGTTGCTGAGGACTCTGCGCGTACTCCTCGCGAACTGGACGCACCGAGTAATGAAGGATCTTGTG
CATCATGACTTTGATTTCGTTTTGGTGGTCCACCAGGGTCGTGTTCACGGCACTCTTACGATTTCGGCTCAGCCTCGCCGACCTGTAGCAGCGCCCTCTC
AACTTAAGCACGATAAGGTCATACGTACAAATCAGTGGCAGCGATGGGAGTTGGCGGGCGCCGCCGTCCTACAGCGCCATCGTTATTTTGACTTGACACT
TCGAGAGAAATACTCACGCAGCGACACGATGCCGGGCTTGGACGTCTTGGCTACAGCAGTATTGTCGGCCATATATAGCCACAATTGCGTTGCTTTGACG
ATCGGACGTACCTGAAGCTAAGCCAAACCCACAGTGGCCCTGGGGGTTAATGCTGAGCAACTTCATTTGGTGGTTGATCAGCTCATCGTAGACAGCGACG
CGCCCGCCAAAGTTGCGCGTGTCGTTGTGGAAAGCTCGGCGCGACGGCGTTGCCGGGGCCATCGCTGTCGGTTGGCCAAACTACACTTGGTGTATGACGC
GGTATGGGGCTAAATATAGGCTCGTGTGTGGACGGACCACAGAGGCGAGGAATCGCATGATTCAAACACATTGAGTGATTACTTAAAGCACGGAAGGGAC
TCGATGTACGCTTTGATGCTTGCGCGAAAGAGTTTGCACTTGATAGGATTCCCGCTCCGTGCGTCGTGGGCGGGGTTCTTTGTCACCAACTCGACGTACA
AGTTGCCGTACATGTGCTGCAGAGCGTCCTGCAAATCACCACTCGCGCAATCCGTGGAGAGAATGAAGCGAAGTCCAGACGGCGTTTCCAAGTGGTGGCA
CGTGTACACGTCTGTTTTGAACGTCTTGAGCGAATGCGTTTGCGGGGTCGACGATGGAGGCGACATCTTGCGGAGGAACTCTTTGAGCGAGAAAATAAGC
CCAAACATGAGTCGCTTTTCTTCTTCTGCGTCATTCAATGTAATGGCGTCGCTCGACCGGTTCCATTCCTCGTACATGAGGCATGCTCCCGACCGATTGA
AGATGTAGAAGTTGTAAATCATTGCTCGAGCTGCCCTTAGCCGCCACACTGGCAATCCAACGAGATATCCGGATAAGGTTGGAGGATATCCGGGAATGTA
AGAACACAACACAAGAAGGAAGACTTCCATCGTTCACAAATAGTTGACAGAACGTATTGCATAATCGCAGTATCTCGAGCTGGCCACTGTGGACTTGCGC
AGCATATACGTATATTGGAAACTCAGGGAAAATAGGAATGCAGTCCATGCTTGACAAGATAATAAGGAATCGTGACTTGCGAGAATTCATGAAAAGAGTC
ACCAGATTATCAATTGTCAACTGACATAATAAATTGTCTAGGATAAAAAGAACGAACCACTTTATTGTGCGTGGGGTGGTTGGTGCTCTAATTGATACCG
ACGAGTTGTCAACATATCCTACACGTCACGTCTACGCCATTCAAGAAACGGCGTAGATGGACCTAAGAGAGCCCTTAAGTTTGAGCTTGTCGGCCCGACG
ATGCTGCTGGTGGAAAAAATATCAGCCTTTGTACGTACGTCCCAGTACGACGGGCCGTAGACTACGTGTTGTACTCGTTTCTGAAAGCCTTTCCAGCAAA
CACGACGATTGTTTGTCCCTCCGAAGGAAAAGATGCGTGCCCTATGGTAGCGTGAAACGCCAGTGATTTCAGCTGAGGAAGAGCGAATGAAAATGATCGA
TCTTACCATCGCGGCGTGGGAATTGATAAGAGTCCGTTTGGAGGGAATGTCATTCTTAACCGTCTACAAAGTCACAATTGAAGACTTGAAGCTCCGAGAT
GAAGAAGCAATACAGCCAAGTCTCGGCGATGCTCAAGATCTCTGGCGTCGGCTTTGAACTATCAACGTGTCGATTCAACTGCACAACTGGGTCGTGGCAA
CAGTTCCTCCAAGGGAAACCAAGCGATGGGCAGTGTGGGAGACAAAACAATTTCCACAGTACGCCCTGTGTCAGCAGTTGTTTGATGGGACACTCGCAAC
CGGTGAGTTTGCAATTACTTCGAAGGCCTCGGACAATGCCATGAACAATATGGACCATGTGTTCCACCAGGACGAAAGCGAAGACGACGATAGCAGATGT
GACGCAAACTCGGTCTCACTTGATGGGAGCCATCGCAATAAGCGGTCTCAGGTGCTCCAAGTGATGCAGGTATTTCCAAGCGCACACGACCAACCATGGT
GTCTTCAATGCTGTCACAAATTGGTGCATTCAATAAAGCCTGTGAAAAGGAATTGGAGCTCCTCGCGACATTGTGTCTGTTCCAAGGAGAAAGTCAAGGT
ATCTAGCTTGGAGCTCGCGATTCAAGTATTGCAAGAAGAATTCGAGGATTCAATGACGTCGTACGACATGTCAACAGCGTTTGAAGTGATGGAAAACCCG
ACAAAAGCGTTCATTTTTTGCGAATGAGAGGTGAAGCTCGCGATGTGTGGCTCCAAAAGCAGATGAGAAAGGTGACATATGAACTAATCTAATTCAAACT
ACTGATGACGAGTCCGTCGTTCTCGCAACGTTTCCGTGTACTGCTCCCACATGTCCGAAGCAATGGAGTCTCACCAAACTTTCGCTTCATTGTTTTTTGG
CGCGTTATTGTCTGCTGCTGTCACCCTATCGTCACTTTGCCCCAAGTCTTGCGCATACTGGTTCTCGAAATCATCGCGGTTGCCTTCAATTCGGAGAAAG
TTGTGCACCACACAAAGAGCCATCAAGAGGTCAGCTTGGAAGGGAAAGTCGTACTGGACAGGGGTGCCAAGAACCGGAAATCTCTTCTTCAGCACACCAA
AAATACTTTCGATGACATTTTGAAGGGATGCGTGGCGCAAATTGAACAGTTCCTCCTTAGTTTTTGGTCTTTGACGCCCACGACCGAATTCATTCAAATG
GTATCGAGTACCACGATACGGGGTCAACGCCTAGGTCGTCAGAGCAATCCCGCGTCCAAAATGTCGAACTGATTGTCGGATATAGTCAATCCATGACTCA
TTGCGTACTCGTAGAGCTTGCCGTCGCCAGCAGTGCCGTCCCATCCCGCGAGGACATAAGTGAATTTCTTGTCGAAGTCGCATGCTGCCAAGATGTTCAT
GGTCACACCTTTGCGACTTTGAAATCTTCAGATCATGTCTTCTCGAACGAACTCTGGCATGTGTATTCCATCGATTGCCATACGGCACTGATCAAAGAAC
GGCGAGAACGTTGGGCTTAGACGTATTTGGTCCGGCACCGGTGCGTCTTGCCGAGGCAACCGAATGTAGATTGGACACATTCTTCGAAGTGCAGCCAACA
CAGCTCGAAAGTGTCGTGAGATAGACTCGCCCTAGTGCTGAAAACGCTCCTGCAGAGCTCGACTGGACACATGATTGCCGGCAAAGTACAAAAACATTGC
CACTTGCTCTGTCGTCGTGATGCGGGCAGTACTTTGTAGTCCACCAACGTCCTCTATTCGGCGGACAAGTCGTTGAAAGCAGACGATTGTCATTCGAAAG
ATCTCAAGTTCGACTCGCGCTTGGGGTTCTTGAGTATGTAGGCATTGTAGTGGTACACGATGTACATCACCATGAGTTGGCGTCGACGGCGGAAAGTACG
CAGCCGCAAGAAACTCAAACACAACGCCTGCTTCATGGGGTGCAACACAAGTTTCAAAACACAGTCTACGCTGTATTTTCGGAATTGCGTTTTTCCTTCA
AAACTGCCGTTTTGGGAATCAAATTTGCGGGCACCCAGACAGCCGTTTCGCAAGATTCAAGTTTCTTTGCCGAACCTTGTGAAATTTGCATGTTCTAGGG
GACTTACTGTGGTATTGCATGACATGCAGATGACATCCAGATGGGCCCTAAACGAAGAACCGATCAAAAAGCCGTTCAAGAATGCCTTGTCATTCAAACG
TAACGAGATATGAGCTCAGTTTGTGTAAGCACATGTGGATTCATGTAATTTGAACGATTTGTCTTGCTCAATATTGCTGAGGCAACAGTAGGCCATGGCG
ACAACTCTAACAAAGCCTGGCAGCGATCCTGACCGCCCACAGTCATGGCAGGTCGGCCGTCCTTGTGATAGCAACGTGGGGCGGTACGATTCCGCAGTGC
CCGACCGTCCAAGGTCATGGCGACTTGGCTTGGCTGATTTTCTTAAACAAAGTTTTGAAAATTTTAAGACTTGGTCACGCAGGTCGGTCGTCCTTGTGAT
AGCACGTGTGGCGGCACGACCCAACAGTGCCCGACCGCCCACGGCCATGGCGACGTTGTTATGCCCTGTGACAGTGTCGCCGTGGCCATGGACGGTCAAG
CATGTCTGACTTGTGCTGGAGGAGTCCTTCGAGACCAACAAAAGTCATGGTGACACAACACATGGTAGTACCTGGGTTGGACTGGACAAGCCGTTATTTT
TAATATATTTTGTGCTTATTGGGCGAAGCAAAACTGATATAGAAGTATCAGGAGTGCTTCCACACCTTCAACTGTAAAAATATTTCTAAAGTCATTACAA
CGCTTTGCCTACAAATTTTCATATTAAGTGGAGTACAACTTCGTCGAGTTTTTATCAAGCTGACTGTAGTGCTTGGATGGCACGAAGAAAATCCAAAGCC
GAGAATGTCCGTGTTCGGCGAGTTTGGAGGCTGATACTTCAACTCCATGTTCCATCCATCTGCCATACATTCATTGATGATATTGAGGTCCGACGTTGTT
CTGCTGGCGCTTGGACTCGACTGCCGACCACTTGGACTAAATTGCTGGGATCACGTTATCGATCAGCATAGCCTTGTACACGTCACGGGTTACGCTGACC
GGGGCAGAGACAAGGGTTCAGGCTGGGCGATTACGGCTGCTTAGAGCTGTTAGCAGTTTCTCGGTGAAGTGCCACGTGCCTATCTTGTCATCAAACCACT
CTTACTTCGCGTAGACCAAACGCGTCCGGGCGATAGCAGAAATGAACGCCACTTTGGCAATGAACTTCTTGGACTTGCATGTGCGTGGGTCGGCTCTTCT
CCAGGAGCAAAGTAATTGGACTTTTTTTACCGTGGTGGCGAAAAAACCACTTTTCGTCAAGTAATGCGGGCAATACCCATCATGTTTGAGATGACATGGG
TGTCGTCATCACGAGCGTGCACAATGTTGGGATCCCGCTTCATGCGCACCACCTTGTTAGCGTCCGTATGACCAGGTCGGACGTAGCTCGAGTACTTGGC
AAAGAATCCTTGCTTAAAACGTTCGTGCAATTTAGAATGTGCAATCCCAAGGGCAGCAGCAACCGAACGGAACGTGACTTTGATGACTTTCGCAGTCGTT
CAGCTTCAGAATGGTACGTTAGTTTTCTACAACAACGAGCTTTTATACGTGACGAGACTTCTGCACATGGACGTAGTTTGTCATTGAGATTGACTGCTGC
TTACTTCCAGTTGAGACGAACTGCGCTGCGAGTAACACCCAATTTCGATGTATCGACATCAAGAGCGCATCTGGGAGCTAGGATTCAGCACTGACAAGTG
CAAGCCGTTTCTGGAGAATGACATTCCGATCAGAATCACTGAGGTTCTTGGTGCCCATTTCAAATTTGACCGCGATTGCAAACGACATGTCCGGTTAGTT
CCCAAATTTTCCGGAACCGGAATTCCACACATTTTTTTTGCGAGCTCAATCGATATAATTGGACATAAAGTATTGACAGTGGTGGGCGGCATCGAGGGGA
TTTCAACAAAAACTATAAACTGTTGGAAAAAGTTCACAACGTGCATCCATTATCAATTTTTCCTTGACCTGAAACTTTATAGGGTACAAACTTGTTCAAA
CGATCAAGAACGTCTCGAAAGCTCGTTCCCTCGCAGTACTGACGTCCGACATCACCCTTGACGATTGCCCATACTAACTCAATTGGTTGTAGGTCCGAGT
GATACGGCGGAGTGTACACAACGGTGTGCCCTCGAGCACTTGCCATCGCGACGACGACAGGACGTTGTCATCAATGTGTTTGCTCAGGTACGTCCACAAC
GTGCACTTCGGATCGTTGCAGTTGAATGAGATCCCGTAGGTTCTGCACGCGTTCTGAAGACGGTCTTTGGACCAACCGTATCGGGGGGTGCCATGCGGTA
AGCACTTATGATACTTGGCGTTGTCCATCACGATTGCGACGTTAGATTGGCCCAAAGCATCGAGCTCGTTCAGCAAGGTACCAAACCAATCCACAAAATA
CTCGTGGTTGAACATTGCATGGTAGTCTTTCGGCTCCTTTCGTCGGATCTCCCCACTTTGGAAGATGTCTAGTGCAAGTAGTTTAGATTGCTGGGGTCCA
CCTTCTAATATTGCCGCAATAAAGTAATATCTTTGGCGTTGGTGTTTTGCTTTTACTTGCAAGTCTTGTTCGTCATTCGGATCGTTCAAACCGTCTCGAT
GTCGAGCGTAGTGGTGGTGGACGATTCGTCCAGATAAAAAACCGGTTGATTCGCGGCAGTTACTCGAGCCATCATTTCGGACACATACGTGTCGCGCAAA
ATGGCTTTTCGTGCGGCCAGGGCAAAGGTTAGTTAACCTTTTATTTTTCCGCGTTTGTAGCGAAGGCGAACGAGTAACCGCCGAACGTTTCGACATGCAG
ACAGGACAGCTCGGGGGTTGGACGCATCGAGTGTCAAAATTTGATGCTCTTGTAATAGAGCCAACACGTCTTTTGCAACGGTTCGTGTGCGGGAAAGTCG
TCGATCGCGCACAAACGTTTGGATGAGCGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN