Description :
From Genome Similarity Track
Location :
Scaffold_1028:9384- 10800
Sequence
1416 bases(100 bases per row)
TGCACCGTGGCTAGTACCAGTGGAGCAAACGACTTCTCGTTCACATTTCCATATAGCCCGTCAAACATGCCCTCGTCACTGAGCATTATTTTGAGTGACA
AAATGACCAGGTGAAGCGATACCAAAGTAGGATACGTTTCACCATCGAGTTTCTTGGTCGTGACGCTAAATGGTGCAAGTAGCTCAATAAGACACTGAAT
CGTAAAGAACTGCTTTGCACTGGGAAGATTCAACTTTTTCGAAGCGGTATCGTCAAACTCCTTCAAGCCTTTTTTTATCTCAGGTAAGTAAAAAAATCTT
TCACCGCCGACTGCAGCTCTACAAACCGCTGGAGCATATCCATCGTACTATTCCACCTTGTTGGACAATCAATATTGACCTTGAGTGGTTCTTTTCGCCT
TGATTGAACTCCATCCAGTCGGTTGCGTCCTTTCTGGGAGCGGTGGAAATATTCCGCTAGTTTTGGGAAACTACGAACTGATGTGTGGGCCGACTCCATG
TCAACCGAGCTGACCTCCGTGTCCGCAACTTTCTCAGCATCTGCAACAAACATTGCAACTTGCGTGAAAAGAATATCGATGCCAGCAACACTAACAAACT
CGTCAAGttcaccgtcgtcttctgtGACATTTTCCCGAGCGTCCAACTGTTCATCTATCCACGAATATTCATGTTGGGTGATTGAAACATCATGTGTATT
GGggccaccaccacttccagCGGCTTCGACACTGGTGACATCATATTGCCCCCCGTAATTAGTTACGGTACCATCAGCATCTGTCGGCACTTGGTTTACC
GGCTCTTCACTTTTCATCAAaagtgcagcagctacaaCCAGGTGTAGAGAATGCGCTGCGCATGACCTATGATTGAGACCAAGTTTTGTGCATGCACTAG
TAATGTTTGACGCTCCATCTCTTAGAAACCGTACGCACTTCTTCCGATCGAGACGCCACCATGAGAAGCAATACGAGAGAGCACTCGCAATCGATTCCCC
ATCGTGCTTACCCGGAATGAGTCGTACTTCTAGGGTCCATGACTTCATGTTAAATGACGCATCCACGTAATGTATGGTAAAGCTGATGTAGCTTTCACAT
TTTATCGATGTCCATATATCCGATGAAACCGAGAAAAAATCGCACTCACTGTCATCGGACAGCATGAGTCTGAGTGACAAGCGCGATTCACAGGCTTGCC
TATGAATTTGCACCGTAACCGTTTGACGGGATGGAACCACAAGCGTTCCCCGCACACCTTTCGCAAACTTTATGGCCCTGATGAACCCAGGATCGTTGAC
GATGCTTGCAGGCCTCATATCCCGACTGATCCATTCGCCAATATAATCTCAAAACGACTCTGCTCGGATTCCGCTGCCGTGTCGAACATGTTTTTCAGTT
GTCTGGATGCCTTGAG