Description :
From Genome Similarity Track
Location :
Scaffold_1081:9384- 10674
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1081-fgenesh-gene-0.1Ww domain protein (E3 ubiquitin ligase) protein 1, isoform b

Sequence
1290 bases(100 bases per row)
TCCGCGCAGAACACGTTGCCACACAGCTTGCAGTGGTGCTGTAGAGAGATACATATCACGACAAGTTAGACACATCAAACCACTCCACACTGCAGCATAT
CATCACACAAAGAACAAAAAAACTTACGCGTCGCCGAAGTACACCAAACTTGCTGTTGCACTGGAAACAGCCGCTCGCAGCATCATCGCGCACCAGAATT
GGCGCAAAGTACCGGCGTAATCGCAGCTGGAGCTCCTTATTCACCACGTCGTCGCTGGCGCTAACTGCTCCTGCAGTCGCAGTCGCGAATGCGCCAGGGG
CGGGCGGGAACACCTGCATCAGGTCGCTCTGCTTCTTGATCAGACTGTGCTCCTGCTGCTCTTCGCGGATGACGATCGTCTTGTCGAAATGCGGCGACGA
GCCTTCGCCGTTGCCGACGGCTTGCATGCCATCCATCGAGAGTCTCGACTCGACACCGGGGGAGTTGTAGCCCGCTGACGGTCCGCCTCTCGACGCCGCC
CCATGCCCGCTATCGCCACGAGGGAGGCCCGCAGCACGGCCCTCGCTGGCGTTCGACTCGTCGCTCATGCGCGACGTGTTCGCGTTGTACATGGGCGTCA
TCAGGTTCAAGCGATCGCCGTCCGATCCCGCGCGCGCGGCGCTGTTCCTCGTGTTCCCGTTGGCCGCCGGGTCCATATTCGTTGGTGTCGAGCCGTCGCT
GGCTGCGCGTCTGCTCTGCCTCCTGCGGGCGGCCACGCGCGGATCCATCCAGGTCGTGACCTTGGTGTTGTGGTCCACAAAGTACACGCGGCCCTCGGCA
TCCTTGAGCTCCTGCCATCCGGGCGGCAGCGGGTCGCTCGTCGGCAAGTGCCACGACGTCTACGCATTACATTAATTCAACAGAGAGAGAGAGAAACGCC
ACACACGTTAGGCTCATGGCCACCATATTCGCCCAGGCACATATCAGCAGGACGCCCACCTCGCGCGTGACGTGGTTGACGTAGAAGACGCGCCCTCGGG
CGTCCTTGACGCGCTCCCACGCGCCGTTCATTCCCTTCTCTCGCCCTCGCGCTCTCTCTTCTGCGGCACTTTTGGAAAATTGTCGTTGTCACGCGACTCA
CTGACCTCAGTTGGCCAGCTGTACCAGTTTTTATGGTACACTGTGCGAATTGGTCCTTAAAGGTACCACTTGAGATGGTACATGATGCCTCTGAGTGGAA
CATACGCACGATGCCCATCTCCACGGAGTGTACCCATCGGGTCGTGATCAGCTCATTTCGAAGAGGCCTTTACTGTGGTGCTCTCTATGA