Description :
From Genome Similarity Track
Location :
Scaffold_3:93821- 96267
Transcript NameFunction/comments
Physo_108215Geranylgeranyl pyrophosphate synthetase (GGPP synthetase) (GGPPSase) (Geranylgeranyl diphosphate synthase)
Physo_127817hypothetical protein

Sequence
2446 bases(100 bases per row)
TAACGACTGTCCTACTGTACCACAGAGACGGGAGGGCTCTTCCGCCTGGCTGTGGGGCTCATGCAGGCGTTCAGTGAGTGCACGCTGGACTTCACGCCGC
TCGTGAACGCTCTGGCCGTGTACTTCCAGATCCGAGACGACTACGTGAACCTGCTGGACGAGACCTACATGGAGAACAAGAGCTTCTGCGAGGACCTGAC
GGAGGGCAAGTTCTCCTTCCCGCTCATCGTGGCCATCCGAGAGAACCCGCAGGACACGCGCTTGCTCAGCATCCTCAAGCAGCGCACCAAGAGCACCAAG
CTCAAGCAGTACGCCGTGCAGTATCTGCGCGAAACAGGGGCGGTGGAACACACGCTGGCCAAACTGAACGACACGGTGCAACAAATTCGCGACGAGATCG
CGTCGCTAGGAGGCAACCCGGCGCTAGAACAGATCGTGGATGGATTGCATGCTACAGTCAAGTAGAACCACTTTTTGACAAGACGAATGTCGAATCTACA
CGTCTATTTCATGTTAAAGAATTATTCCGCTTCCTGTTTAGGCTCTCCCACCTCCACCCACTCCATCTCCAGCTCTCGTGTGGTCATTGCAGTGTTTGAT
ACGCTGGTTTGTGCTGTCGGTTGCAGGCGGAACTGACAGAACTTCGTCGTGGAGTTTGACGACGCGGAAGTGTTGCCATCGTCGATATCCGTAGCGCGGC
TATACGTGCAGACGGCTTCGTAGATGTCCATGAAGCAGTTGAGCTGGACCCATTCCTCGCAGTCGTCGTTACTTACGCACGATATCGTGTCCGCCCCAAC
GTCTTCGAAGTCGCACCACCTGCCTCCGGTGATCTGTAGGTCGAACACTTGCACGTCGTCCACATAAGTATGGCAGGACGGGAAGAACGGCTCACCCGCT
GCAGCATTGGGGAACCAGACGCCGATTGATAGCGAGTTAGTCGAATCGGTCTTACCGTCCATACCCACTTGCTTCAACACTAGCTGGCCGTCCTTGTAGA
GGTTCGCGCGTGCTGCACTGGCATCCCATTGCATGACAATCTCAGTGTACGCTGCGTCGTCTGTAGGTTCTGGAGGTGTCAGTGTGAAGGCGATATTAGG
AGTCGTCTTCGCTTGGTACAGAGCGGACTTCCATAGCGGCAGGAACGGTAGAGCGCTGCTAGTGGCAGCTTCGTAGCTGCCCCACCAAACCTGCGTGAGC
GTACCGAACGCAGCACACGGCTTGATTCGGAGGACCATCACACCTGCGTTCTGTTCCAGCACCGACGTCACCGCAGCTCCGACACGTCGAGCAGGACACC
ACTCCAGAGGATTGCAAGGTAGTGGACTGATACCATCCAGAGCCCATTCCATGAATCGATCACTCGTAGTGCGGTCTGTCAATGTGCCGTCGCTCCCCAT
AGTCTTGCCAATTGGCGCAACTCCGGCGTATAGATCTCCATTAGCAGTCAGCTCCAGTACACTCTTACCAAGTGCAGCGTCTCCCACACAGCGCACGTTG
TCCGAGCTCACGCCTCCATTGACGTTGCTGCCACCCCATTGACTCGTCACAGCATTCCAGTTCGTATTGGTCTGCATGTTGCCGGCCCCACCATTGCCCG
GGCATTTAGTAAAGTCGTCTTGCATGAGAAGTACATGCGCGCAGGAGTCATACTGGTAAGCCGATCTTCCTGCGCAACATTTATCCAGCGTGACAGTGAT
ATCTGCTGAGTCGCTGTCTTTGAGACCATCTAAGCAGCTCACAGCCGATACCAACACGGCTCCAGCGCCTACTTCCAACGGAGACTGGTACAGATCTCCA
GAGGTGCAAGTTAACGCCTTCTTGTCTCCCGCAGACAAGATCTGGTAGCGCACAGTAGCGCCAATAGTCACCGCAGCAAGGTTCACCACTAAAGTCAGCG
GTTTGATCGTACTACACGCCGTGCTATACGTCGGCGTCACAGCCTGGACGTCTACAGGGCCCCATGTGGCAACGACGCTATCGGCGCAGACCACGCCGAC
GCAACACGCGACGGCCCGAACGACGTCGAAAACTTTCACAACCAACTCGATTCCTCCCGAGGTCAGCGCGTTGCTACACGTTGGTAGTTTTTTACCCTCC
GACAGGACCGAGTAGGCAATCCCTAGCTTCTGGTCGTTGGCACTTGGAGGAGGAACGATCGTGAGATTCATGAATCCGCTGATTGTAGTGGACGGAACGA
CGTAAGTGAATGTCGGCTTGCGAGGATGCACTATCAGATCCTCCGACTCCACGAGATTGCTCTGTAGTAAATCCGTTCCACACGCCACCGCCCGAATCTT
CGCATTGAACGTGACAGATACTTTCCCAGTTGTGGCATTTATCGCTGAACCAAATGTGCAGCTTGGAATTAACAAAGACCCTCCGTCTACGCCATCCAGA
GGAACGGTGATGTAGCGGATGAACTCGCAGTCGGTGCACTGGAGAT