Description :
From Genome Similarity Track
Location :
Scaffold_208:9380- 14035
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_208-fgenesh-gene-0.1Chromosome 03 contig 1, DNA sequence
Pytap_DAOMBR444maker-pag1_scaffold_208-snap-gene-0.22Partner of Y14 and mago

Sequence
4655 bases(100 bases per row)
TGGCCTGCACAGTGCAAGCAGTGACTGTGGAGAGCAGTGGGTCTAAAGGGGgCGTCTAGgAGAAGGAGGGAGGAAGGACAAGAGGGCGGGGCGATGCACA
CACAGGCAAAAGGGGAGGGGgACCACGCGgAAGGGGgAGGGGgATTCCCCGCCCAAACTCAAAACCCcGCCGCACACGCTCACACTCCCGGTagCCCATA
CAAACTTTGAATAGAGAAGCACAGAGGAGCGCGGCGTCGATAAAAAACCTCGGGGGAACCACTTTGGCTGCTGTAAGCAACGGGCAACTGTGCGAGAAGG
AGCCAGAAACGACCTCCTCCGCCAGCGCACAGACGTTGAAGATCGAGAGTGCAGAATCAAGGGGAAAGCCCCGAGGTTTTTtAGGAGGAGTGATGCAGGG
GgCAAACTCCATACAAACGCTATTGGAACTCATAGCGTGACTTTGGCCAACCGTTGCGGATGAATGCATCAACGCAATACGTCGTACTCACCACCATTCG
AGAGATCTGGGCCTCCtCGATGAAACGAACCCTTTTACACTTGTATATGTTGCATACATGAAAAgCTATAAGGGATCTACGGAGGGTAACATTTTCCCGA
GCCAACTAGTGTATCTTGCCCTGTGTGGGTTTAGCCTCACAGGCTCGAAGCCCAcACTGCAGCTGTTGTTGCTGAATAGgAGGCGAGATGGTGTCTGATC
GCGCTGTTGTTGGTTACCCCATCAGCCGAAAAaaGAGATGGGACTCGAGAAGGAAGAAAGCGCCAGACAAGAGAGGAAAGGCTCGGAGACcACTCATTGG
TGCAAACAGATAAATTCCGCCAATGAGCGATGAGAAAATGAACCACTGACGCtGgATTGCGGCGAGCCTGCAGTCGTTCCTTTTCTTCTGTAGACTGGGG
CTGATCCCGTCGCATTCTCACCCACTCATACAGCACTCTGGGAAGAGAGCGCGTGCGAGTGAAAGAAGGGACGAGGGATTGGCGGAGCCGCACAGAGCTC
ACGCGGTCGAAAAACCTTGGCCCAAGGTTTACCAAGATTCGAAATTGCGATAATAGACATGCTTTGAACTCGACCTCACGTTCTGGAACCACGTGGTCGG
ATTTGGCGCGCAAAATCTGGAGATCTATCTCTTCGAATCTAAAGATCGGGAACGAAAATGGCGGAACCAACACCAACGGAACAGCCAACGACACCACCAC
CGGCGCCCGTGCCAACGGAGGCACCGAAAGTGGCGCCGAAGGCGAAGGCCCCAGCGCACTTTGAGGATGCGGATGGGCTCTTCAAGACTGTCTGCCGTGG
CTTCATGAGCAAGAAGTGCTCCAAGCCAAACTGCAAGTACGTTCACGACAAGCAGCTCTGCCTGTACTTCTGGAAGTCCGGCGAGTGTAAGTTCGGCGTG
GAGTGCAAGCGAAACCACTTTGTGACGGTCACTCCAAAGGCTGAGAACGGTTCTGAGGAGAACAAGAAGGACGAGGCGGAGAGCAAGACGCAGGAAGGCG
AGAACAAAAaGGAGAAGAAGCCAAAGCAGAAGAAGGAGAAGAAGAAGCCGGAGACAAAGGGTGAAGAGGCTGCTGAGGACAAgCCAAAGCAGGAgAAGAA
GCCGAAGCAGGACAAGAAGAAGGATGGCAAGAAGGACGAGAGCAAGGACAAGGCGCGCGCGAAGGTGCGCGTCGTCAAGGGCAAGAACACGGAGTGCTTT
GAGCCAATGACGAagCCTGTCGACaTGCGCATCACGTATGATCTCGGAGGCTCGGCGGACAAGTTCTCGACTTCGTTGACCTCGCGCGATGTGCTGCTGG
CGCCAAACATTTTCAACGACTTCAAGAAGGGCGAGCTCTACGACAAGCTGCTCAAGGAGCTGGAGGGCTGCGGCATCCCAGAGGAGCGTCTGCTGAAGAT
GTGGCATGGCAACGACAAGATCGAAGGCACCCACTTGATCGCGGACGACAAGACGCGCTGGAAGAACAACTGCCCAACGTTCCAGCTGGTGATCGACCGC
CTCCAAAAGTTCTTCGCCATGAAGGTTCAGGCCACGCGTTTCAACTGGTACAAGGATACGTCGCAGTGGAAGCCGTTCCACTTCGACGCCGCTGCTGTGA
AGCCTGAGATCGCGCAGAAGCAGAACTTCACCGTTGCCGTCTCGTTCGGCGCTACGCGTGACGCTGCCTTCGAGCATGCTGAGACTCGCACTGTAGTCAG
CATCCCACAGCCAGACTCGTGTGTGTACGCGTTTGCCCGTGACACCAACATCATCTGGCGTCACGGCATTCTGCAGGACGTGCCAGTGCGCCAGGAGGGC
CGTATCTCGGTCATCGCCTGGGGCTGGATCGACGGCATGGTTGATCCGCTCGATACGGTCAACCCAACGGCTGGCGCCGCCGAGGCCAAGTAAGTGACGT
AGACGCGAAGCAAGTGTTCAATAGACCCTCACGTAGAGCATCGACAGAGCAGAGGGAGAGAGGAAGTGAATGGAGTCAAACAGCGTGATGGTTTACGGAT
GCGTTGTTCACAGCTCAATGACGCGCAGCGTCTTGGGCTTCGCTTGTGATGATGATGTCGTCTGTGGTTTGCTGTCGCTTTTACCATCGAGCTGATCGAT
GATGGCGCGCTTCCGCGTCTCCAGGTCACGCTTGCGTTGTACCTTACGCCGCTGCGTCGCAGTCAGCGGACGCGACCCGGGATCTCCGCGTTCAGCGGCC
GCGTCGAACTCTTGCAGCTTCGCGATCTCACGCAGTGTCTTGTTGATGTCGGACAATTCTTTTCTAAGCTCACCAGTGGACGAAGCGGCACTCGACGTAG
ACGGTGGAGGAGGTGGTGGTGATCTCCGTCGTTCTTGTCGGGgTTtGTCCATCCTCGGTCTCGGCGAACGCGATCGGAGTCCACGTCCAGTATCCGCATC
AGCTAAAGCGGCGCGCTCATCCTCTTTGGGCGTCAGtGTGAGcGCATCtAGCTGCTCAGCCACTGCGTCCGCCTTGATCTCAGCCTGTTGCTCTCGCTTC
TTGGCTGCTTCCTGCTCTCGAAGCCGTTGACCCATTGGCTTGTACTTGGGCACTTCGTCCTGCGGAACGTAGCCCTGGCGGATGCGAATGGCCTTGCGCA
CTGAGCCATCGGCGCGGCGGCTCTCGGGCACGACGACGTCGCCGTCAGCAGTGCGCACTGCGCCGAGCGGCAACGTCGCTTTGTTCATGCCACTCATGgT
CACtaCTTGATTCTGAAAATACCGTAAACAATTCACGATAAGTTGgTCATAAAaACGAATACCATATATACGGTATTTTACACTTTCGTTTAACGTATAA
ATGGGCAGTCAAAGGAGTCCAACTGCTTGAGGGCTGACTGAAGTGAAGGCTGCCCGACTGGTACTCACCACAGCTGCTCCTGTTGTCACTGGAAcAGTTA
GCGGCAGTCGATtcATCAGATGTTGCTGGTGTACCTTGGCCCGATACGCCACAAGCGCTCCAACAaGTCCCACCGTCCCCAACAACAAACCTATGAAGAG
AGGGCTTGTGAGCACACTATCGGATGACTCGTTCGAGAAGCCTGGTGGACGACTAGGCTTTGGTGGAGAGCTTGTATCGTCGATTTCCTTACGTGGTGGC
GCTGGGGTGAGTGGGTGGGGAGTAGaTTCACCATTCGGACTGCTCATAGTAGGATCAGGGATTGAAACTCCAGGCTtGTCCCGGGgCGgCGCTGCAGGCT
GAGAGCTTGTATTGTcGTTtACTATCGGAACTGGTTCAGCTGGAGATGGCGGTGAGTTACTAGTTCTGGATGCGGGAGGCTGAGATGGTGGGGAAGGCGA
AAAACGAGGTGAAACTGGCAATGACGAAGATGCAGGCGGTGGTtCAGGCTGTTGCGTTGTAATCAAGTTCCCTGGTGCTGTGCTAAGAGATGGCAATGTG
ATGGGAGTAACTTCAGATGACGCTGGTTGGAGCGTTGGGCGAGGCTGGAATGGATGTGGATTGGCGGTAGGAGAAGTAGACGTCAGTTCACTCGGATACG
GaGGCAACCAATGTGGCGGATGTGTTGGTACTTCaggTGATGATGTGGTTGGTGTAGGAACCAGGTAaGGATGATCGACAGGGTCATTCTCGATGGAGTT
CGGTGCTCTTGTCGGAGCCACACCATTAGGTTCTTGAGTCGCAGCGCCATCAGATGCAACCGGTGTTGAGCTGCCTCCAGTCGGCTCGTATGTCGTTGGA
GTCGGACTTGATTCGATCTGTTCGTTATTGCCAGAGTTTGACCCATCGCCTCCAGCACCATCCATCCCGCTACCTGAGCTGCTCGCACTCCGCGAGTCTG
ATGCATCCGCAGATTCATACTCTGTCTTGGTCCTCAGCACTTCATCATGGCGAGTGACTGAGACGCACTCGCCTGGCATCAAAACCACTTGCTTCCTGAA
AGCGCGTTTGCTCCGTGTTGATAGATCGATTGTCATTGTACGCAAGCCCGAACGACTCCGCGGGTCGGTGATAATATAACGGAGTGTCGGGGAGGCACGA
TCGAGTCGGGCGAGTCGACTGTCTAcTCGAATGGCGTTCACACCAAGCGTGTCGTTGACAGGTTGCAACGCAAACCATTGGGGTGCGCTTTCGCGCATGA
GACATACGGAGACGTTCTTGTCTGCGTTCGAAGtcACAGGACAGTCGACAAACTG