Description :
From Genome Similarity Track
Location :
Scaffold_1185:938- 4946
Sequence
4008 bases(100 bases per row)
CCCCCCTACTCTTCTTCACGAGACTGCATCACGCCGAATCTGTTCCGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CTTCGTCTACCCAACTGGGTACGTCATATCCCCGCCAATACACCAGAAATTAACGGTAGATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGT
GATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCCAACTATCTTCAGGTAGGAGGACTTCGTCAAAATCCACCCGGTCGGATTCATCCACC
GAAAGACGGGTTTGCGGCCGATCCGGATATTCCTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCGGTACCTGCCGTTTCCA
ACTTCACCGCATGTTCCCCTATTTTTTCGCTCACCCGGAACGGTCCGTGCCATAGATGGGCCAATTTGCGGGCATACCCTTCCTTCACCCGATTTAAATA
AAGCCGCACCTGCGATCCCACTTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCTTGTATCGCACTCCGCAGCCGTTCGTTCACT
TGGGATCTGGCTTGCCGATATATTTCTGGACTTGGTATCGCCATCGTCTTGGATCTCGGTTTCTCTTCTTGGTGCTGCATACTGGGATGGCCGCTTCCAG
GGTGGGTTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTAC
TCATCCCAATCCCTCTGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGAT
ATGCCATGGTTGCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAGCCTGGCTCTCGATCATGTCTAATCATCTCACT
AGCCCCAAATCTTCGGAAAACGCACTCCTCGTACGTTCGGCAATGGTTTATGCAGTTCTAGACGCACTAGCTTTAGCTACCACGTATCCGGTAAACAGAT
CCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATT
CCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACTCAATCACCGATATATCGTTGAACGCTCTTGAATAGTCCCCTCCAG
TGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATCCCCTGATGTCCTCCTTCTAAACTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTT
CTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTCGACTCTCTTCGTAGGGGGACAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGT
AGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGCACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCTTTGTTCTGT
GCTTTGAGGATCCGCTCAATGTGGACTCCCTTAACAAATGTTTCATCGAGGATCTGGGGGCTGGATCCAATCCTTCTTCTGGACCCAGTGACAGCCATTA
TCTGGACTGTCTTTTTCCCGGATCCAACCACCACCACCTCATTTAGTCGGTTCAACATAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCGACACC
ACATTGATTCCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGG
ATCATCACTTTCTGCCGTAACAGTGTTAGGGCGGGCCTTGCCGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCACAAATCACCAGC
CTTTTTGGATCCTGTTCCTTTAATAGATCCAAACCCAGCAGGAGCCCGTTATACTACGCTTCACTGACGGTGAGGCCCTCTGCATAAGTGGATCTGGCCC
GTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAATTAAGGACGTACAGATC
CTCATCCACTTGTACCGTCGGGATCGGGGTTTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCATCCATCTTAGCTCGAGGT
GTGATGCTCGCGGCCAAGACTCCCAGTATCTCGTCTTCCCCTTTCAAACATTTCACGATCTCCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCA
AACGTCCTTGTAGCCCGGCCGACTTGAACAGCCAAGCTAACGTAGAGTGTCGAGTCAGGATTCGGATGGATCTTCCCACCAGCAGGCTGTAATTGAGATC
CAACACGCGCAGGAGCGCGAGTATCTCCTTCCCCACCGCTTTGTAGTTCAGTTCATTTGGCTTTAGCGTCCGGCTGACGAAGGGGACTAGATGACAGATC
GCTTCATGTTCTTGTACCAAGACTGCTGAGACTGCCCAATCACGGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATGGGCG
TAGTCGCGATCCTGTTCCTTAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGATGTTCCACCCTTTCCGAGTTCTGATCCGTCGTCTCTATCCCGAT
TGGATCCTCTTTCCTTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACTACTTGGATCCCTTCGTAAATCCGACATCTCC
AGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCCCTCAATTCATATAGTACCGCAGCAAACAGTGCGT
AATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAGGAACAAGTCTGCCAACGAAGACAAGTC
CTTAGGATTCACCCCCAGTCCCTCCTTGGAGACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCGCTTTACTACGCTGATAGAGAGATTC
CACTTAGTACACGTCTCCAGTAGGGATGCCACTCTCTCGCACAACAGGTCCCACGATTCCGCCGGGATTAGAATGTCGTCGATATATGATCTGCGTCCTA
ACACAGACGGGGTCCCAGGATCCCCTGACTCTCCTGCTTCGAATGGATCCACTTCCGTATGATCTTCCCCGGATCCTCCCTTTTCGGGTTCCGGTATTCG
GGTGAATCCGTAGAGGGAGTTATCGATCAGGCGTTGGTAGATCTGGGGCGCGTTCTTCAATCCCACCGGCATCCGGTTCCACTCGAACAGTCCAAACGGT
GTGATGAATGCGGAAATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAACCACTGGGCATGTCCAGAGAACGGAACCATAGTACTTTATCCAAAT
CCTCCAATAGCTCATTGATTAGAGGCATTGGATACACCATCAATCGGGTCAGGCCGTTAACTAGCCAGTAATCAATGCACAGACGTATATCCACACCGTT
CTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTCGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTGATCAGATCCGATAATTTTTCT
CGGAACTGAGGTGCCACTTTCCGCACCCTTTGAGCGATCGGTTTCACGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAATGCAT
TACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAACCGATCCACTTCCGCGGGTTCGTTCGCCCCTGGATCCACTTGGATATCGTT
AATCGTGA