Description :
From Genome Similarity Track
Location :
Scaffold_172:938- 2815
Transcript NameFunction/comments
g6215.t1hypothetical protein
g6216.t1XP_009532708.1 hypothetical protein PHYSODRAFT_249081 [Phytophthora sojae

Sequence
1877 bases(100 bases per row)
CCGACGCCAACTGCGTTGGCGTCGTCAGGACGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAGGCCGCATACGCGCATGATGCGGATGCGAAGCA
ATTGGTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGCACACAATGGTCTG
CTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGTTGAACCTCAAGATCACGTACGAGTACCACGATGCCCCGA
TATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGATACGCAAGTACGTTCGTGCTTG
CGAGGTATGCCAGCGTGTGAAGCCTGCGCCCAACTCGCAGGCTTCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTC
GTTTTTGGTTTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCAGTACCAGCCGAGG
TGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATACCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGC
GCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCATCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGC
GTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTAT
CGACAGGGCACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGGTATCC
GGTTAATTCAAAACAACGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAACACAG
TGTCTACGACGAGCGTAGACACTTTAAACAACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTC
GGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGATAAC
ATCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTCCTGTTAGCTACTCAGAACCTAGCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTT
CATTGGGCCATTCACCGTGTTGGCGAAGCATGGCAACGCGTACACACTGAACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTACGTTGGGCGGCTG
AAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGACTCGCCAAAGCGCTCTCGAGCGCGGCGACGCGCTTCGAGACGCCAGAGAGTCTCGTCCCGAC
CTCGACCTTTACGTTTGAGGTCGTCTGCGCAACCTCCGCGAGCTGAGCCTTTAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCTTGGAGA
CGCTCAACAGCCTCCAAACGAGACTCAAGGTTTGGTTGACCAAACCCGGGGCGTCTTCCCGCCCCCCACCCACCCCCGTTGCGAGACGCACGCGGGGCAA
CTCGCTGGATCGTCCAGCGAATTATTGGTCATCGGAACCAGACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGAGA