Description :
From Genome Similarity Track
Location :
Scaffold_20:9377- 18893
Transcript NameFunction/comments
Phyke_g1237hypothetical protein PHYSODRAFT_313186
Phyke_g1238hypothetical protein PHYSODRAFT_488938
Phyke_g1239hypothetical protein PHYSODRAFT_313188
Phyke_g1240hypothetical protein

Sequence
9516 bases(100 bases per row)
AAAAGCGACGTGCAGTTTTAAATTCGCATTTAGCTCCAGTGAAACCCCCGTTAGTCCCAGTCCCCAAgaggcagcaccagctccatgagctccCGCGTTA
GCTCTAGCAGCTCCCGAGGCCCGAGCTATGTGTCCGCcagcaagatggagaagccCCGCAAGATCACAGCCAAGGCTGACGAGCTGGACACATACATGGA
GAAGCTCTACGACGACGATGTGGAGTCCAAACTGGACGGAGCCAAGATGATCCTGCAGCTGGCAGAGTTCGCTGGGAATATCGAGGCGCTCGTGCAGAAT
GAAGCGCTCATGGTGCGGTCATAGTTAACTAAAGTCCATGCAAATTCTTCATATTACTACTGTTCTTGTCCTATGGCTGAGTTACTGCTATGCTGTATTG
CTGACCCCAGAGCCTGCTGTCGCGCGTATTGAACGACGACTACAAGAAGAGCTACGACTTCTCGCTCACGATGATGCGCATATTCTGGTGTTTTTCCaac
ttcctgcagcttcatccgATGCTGGCTAACTACCGCATTGGAGCCATCACACTCAAGATCATCGAGTTTGAGTTGAAGCGCCACCAGCTACGtcttgaag
aggagaaacttctggaggctgcagccttAGAGCCCCCAATTCATGCTGCTAGTGATGTCTCGACCAAGGAGATTGTTGACAAACTCGACCGTGAGAAAAA
GCgcaacaagaagcgcatgaagAAGCAAGACCAACTACTGTGAGCATGCCAGGAATTCTTTATATGAGCCATGCCAGCGGATTGATGTTCGACTATTGTT
ACAGTTATGTGTGCTTCAGCGTGCTGCTAAACTTGGCTGAGGATATCCATACGGAGAGGAAAATGGTGAAGCGCAAGATCGTTCTGTTCCTAACAAAGGT
ATCTCTGATGCATCCTTCGTTAACTCTGGGGAGCATACGACGCGTGTCGAACTGATTATTGCCGGGTTTGTGTTTGGTATTTCTCACATAGCTGCTAGAT
CGTGTGGCGCCCGACCTAGCTATCCTCACCATTACGTTTCTCAAGAAACTAAGTATTTTTGAGGAAAACAAGGACGCGATGGTGGAgcttgctgtggtgg
aaAAACTTGTGCGCTACGTAAACTGCAATCACGATAAAACCATCCAGACAGCACTCAAGCTGCTATTTAATTTGTCGTTCgatccagcacttcgtgAAGT
ACTGGTGCGAAACAGCCTAATTCCAAAGCTCGTGGAGTTGCTCAAGAAGCCGCCCTTCCGCGCGCTGTCCCTGAGAATTCTCTATCACCTTAGCATCGAC
GACCGATGTAAGTCCATGTTCACGTACACAGAGGCTCTTCCAATCGTCATGCAGCTCGTGATCAACTTCCCGCAAAACATTGTGGCGAAGGAGCTTGCCG
CTTTGGCTGTGAACCTTAGTCACAACGCGCGCAACGCCGAACTGATGTGTCAAAACCGTGGACTCGAAGCGCTTGCCTCGCGTGTGTTCCGAACTCGCGA
CCCACTTCTTATGAAAGTGATCCGGAACATATCACTCTGGTCCTACACCCTCCAAGAAGATCTGGTGAGCGATAAGACGTACAAGTACCGTGGAATGTGG
GCCCCTTTCGTTGTGCCCTTTGTTGAGCTCTGCCTCAATGCGGACAACCACGACTTCTCTATTGAGGTCCTGGCTACACTAGCCAACATGACCCCAAGCG
ATCTTCCACCGAAGATGTCCTGGGAGCGGCTGGTGACGGACCACTCACTGATCCCATTCATCAACAAACTCTTAGTGCCAGGCTTCTCGCAAGACGATAT
GATCCTTGAGGCTGTGCTTTTCGTCAGCGCACTCGCGCTGGAGCCCAAATGCGCCCCTCTTCTGTCAGCTTCACGCCTGGTGCGCACACTTCACTCGCTG
TTTCAAGAGAAGCAGCACGATAATGAGCTCACATTGCAACTGCTCTACGCATTCTATCGCATGCTCCGTCACCCAGAGACGTTTGAAGAGATCCTCTTTG
GGGTGGGCTTCGTGCCAGATTTACTTCTTGCAGCGGATGCACCTAACATTGAAGTGCGCCGCATGTGCGACGTGCTCATGGACCTGATTCTAGACAACGA
CCTCAACGATGGCAGTGGTGGGGACTTCGGACACCTTATCCGACAGCGTCGGTTTGAAATCCACAACGCTGAATACCTCGAGATGATTCACGCTGAAACA
CAGAGAGCGTCCTACCGCAAGCACCACGGCATTGATAgcggcaacgacgacgacaatgatgatgatgacgatagCTAAGGCATCCACAAACAAGAATCAT
ATTCCATAGTCACTCAAAGTAATTGTATTCCTCGAGGCGTTTTGTCCCGACGATACGTCTGCTTAGGTACTCAACCAATGTTTTTCGTTGTCAAGAACCC
AATCACACTCTTGCAATCAACACCAAAGCGAGCTAACGCTTTTTCTGGCCAGTAAGAGTTCTGTTGACTGTTGATAGAGGCTCCTGGTGGAATCAGATAC
ACGTTGTATGGACACTCCGGCGAGATCGATAGTGCAAGCGCACGGGAGTTGCACTGCCTTTTATCTGTATAGCGTACCAGTTGTCTCACAAACTTCCAGT
GGTCATACGCAGACTCTAGGCGGAAAAATGCTTTCACCGAGTCATGAAGGTTGCGCATCTCAATCTCCAGTTTGTGCATCGCGATGGTTGTACGTTGTGT
CACCACAATATCCCGATTATCAGGAAACGCTTTAGGCACCATTCCGTCGCGACTACGGCACCAAAATGCGTCCACTCGGAACTCATGGTAACTCTTACTG
TCAGATGCGTCTTGAATCCGGATAAGAGAGGACCAAGCAATAGATGGTGGACTCGCTGGCCCTGGCAGCGACATGCTGTCGATATCCATCttttcatcac
caccattgAATGGCTTTGAGTCTAGACCACAGTCGATCAAATCCACCAAAAACTGTGCCGCTCTCCAATCTGCCAAGCGACGAGCCTCCTTGTCCGTCTT
CCACGTAGCTCGGTACAACACATACCCATCTACTCGTACAGCATAGTGTATACCTGACGTCACATTATAATCCATACCACCTCGACCAAGTGACAGGCGT
GGTGGGTCTTCCACCTTCGTATCAATCTAAGTTTAAAGAATAAATCCACAGTTAGTCACTCTTACGAAGAGAAAAATCatcaagaaacagcagccacctA
CACTGGCGATATTTGACAGCTTGAGGTCATTGAAAGAATCCATCGGCGATACGTACGCCAACGATTTTACGTCCAGGAAGTGAAGAAGTTGCGCCCAAAT
CGACCGGATCTTATTCAACATGGCCAGCATACCATCCACAGCTGCGTTGCATGCCTCAGGCTTTGTCACCTTCGATGACTTAAAGCGTATGATATCGTTG
ATATCGACTGTCACCTCAAAGATACCTTCTCGAAGACGCTCCATTCTAATGTTCGCCGTCACATTGGGAACGATCATTCTGTGCTCAGCTCCCCGATATT
TCAGTGACGCCCGTAGTCTGTTGATGCCAGCGCATAAATCATCTTCAGGGGTGAAAAGACTTCGAATCGCAGCCCGAAATTTCGCGTCATCTGTGCCACT
ACTCTCTGATTGTTCGTCGTATGCTTTCTTCAGTTCATTCTCGAAAGCTGACAGTTGATTTACTGTACTGGGCGTATCCTGCTGTACCTTGGTCACTGAT
GGGTCCcaatcatcgtcatcaaatCCCCCGTCAGAGTAATTATCATaatcatcgtcatcgtccatttcgtcgtcactaCACAATATAAGATTGGTCTTTT
TCGCGGGTGTCGGAGTAGGTAGTGCTTGGCTggtcgctggtgctgcagtctctgcagTATTGATGCTACCGTTCAAGGGGCGTGCACCGGATgttttcaa
cttcttcagcaattCCAGAATATCGCGCCATCTTTCATTGGCAGAACGCTTGGCATCTTTCGCATTCAAGCAGGCCGTCGAAATTGCTAATGTGCCGCGG
ACATAAATGAAATACATAAACGATGGCGGAACAAGCTTCTCTGATTGCGATACCTGCCAGATAGATATGCACAAAGATGACCAATGTAAGATTAGCCTTC
CAGCAACACCTAGCGCGACATGCAAAATACCTTGTCTTGGCTTTTTGCTTGAGTTTCGTTTCCTGCCATCAAAGTAGTGGGCGTATTGGCAAGTCGCTCG
TTGTAGGTGAATAGAAGTTCCCTCCATGTTTCCACCATTCCGTCTAGAGTTTTAATCAGAATCGAAGTGGCCTCGTTCTTTGCATCTTCAATTGTCATGC
CCTCTCCACGGGCTTTGACGACGCTTTCAGACGCAGTTAGCATGCAGCTCACTCGGCCATTGATTTCCTTTGTGGCAACCCGAGAAATCTAACACAATAC
ATTGTAATAAATGTTGAGCATCGTATAAAGAACATCGCAGGGAAGACCTCGGAGTTTAAGTTTCTTACCGTAAATGTTGATGAAATGATAATTGTTTCGC
TTTTGGTGTCAAGGTTCCACTCGATCGACTCGACAGCTTGCATAACTTTATTTCGGTCTCGGAAGAGTAGAAGTAGCAATTCTTGATACACTTCAGACTT
TGCTTTCGCAACCACATCTTCTGAACGGGAGACTGTAGCATCGCTGCGCTGTGCTCCATTTTGATCAACAAAGAAAACAGGGGATGAAGATTCAATGGGT
GCATTCGGGGGAATATAATtggcaggagcagcaggGGCGTGGTAATCTTCACTCTCCAGACCCTTTCGCTCGGAGCAAATAAATGGTTCAGACTCTTGAG
TCGCGTATGAAAGTCGAGGACGAGAAATACCACGGTTGTGTTCGTgatctgctccatctgcgCTCGGCGCGTAGTGTCTTTTCCTTACAATAATTGGAGG
CCTCGTCTCAATGTCTCTCATTTCCTCTTTAGGCCAGCCTCCATCATTATCGCGCAATGGTTCCATGCCACTCTGCATGTATGGGTCACCTTGGTGTAGC
TTGGCGTCATCGACAGATTTCTGGGACTCAAATCCGTTGGGTCGTTCCGCATGGTCGAGTTTTAGACTCTCCTCATGCTGCGTGATTAACTCCATCAGGA
ACATCATAAGCCCGTCTGCTGCCTTACTTCGGGCATCGGTGATAGAAGATTCACGCTTCCAAACCAGCGGGAGTTCTTGGATATAAGCCACTACATCAAA
AGTATCAGGGTTAACAATACCGTCTGGTGTCGGTATCTCATGCAACTGTATACATTGACAATGGCTTAGTATAATAATCATAGCCTGAGCACCTCAGCTT
AGACACACTTACCCGAACAATTTTAGTCGAGACCAAATAGCTGAAGACAGCATCCTTAACCTTTCGGTTGTCATTTTCAGCACTGAGTCCGTATTGGTTC
TTCACGTGTGCCAGCATATCACCGTATAGTCTTCGATGCTCAGATACGGCCTTGGTAAGCCGGCTGATCGCACGGATTGTAGCCTCGCGATCAACCGAAG
CAGTACACTCAAAGCGCAAATGGCCCAACCGGACACGAGCATTATATTGGGATGGACCAACCGTTCGCAATTCACGCCAAAGCTATAATGACAAAAAATA
ATCACCGCCTTACAAATCATCCACTGAGCAATAGCTAAAACAAAGATCGCACCTTGACCCCCGGAGTCAACCTAAATTCATGGCTCATCTTTGATAGTGA
CGCCATAGTCTGAACAGCCACCAtcagttgctgaagagatGACACAAGGTCGACATTAGGGCCGATCAAAGCGAGAAGATATGCTCGGCCCTCGTCCACC
CTGAAAGTTTTGGGCTTTGCTGCGACCTTCATTTCAGCTTGTTGCTCCTTCCAAAATTGAGGTGAGGCTGTAGCTTGGgttggtgcagatgctgcCGATG
GCACACTCATCCGGCTTGATTGCTCGAGAGCTAGAGCAAAACTCACTTTTTTCTTTGGTGTAGCAGGATGAGTAGGCGCCACGGATGAAGAAGTAATTAA
AATACCTCGTTTCCTCGGAGTCCTGTTAGGTCCACACACAGCTGGTTTGGCACCCATGTCGACTATCATTTCCTCCACGGGATGGTGCGACACTTTCTCT
CCATTGGCTACCCTACCATCACTTCCGACAGCTCTTTCCTCCTGCTGCGACGTCGTAATCGAAGCATACCATTGTCGGAACTGGTCTGCAAAGAGGAGCC
TCCTGTCCTCCATCAGAGTTTTCCTCGTCTCACAGCTCATGATCTTCACATACTGCAGCAACTTTTTAGCTGAGTGCAGCCGTTGCACCGCCAATCGGTT
GGACCTGATCAGATCTTCATATCTCTTCACTAAATATTGGTGAGAGCTGTCAATTTCATCCAGGGTGCGTAGAATTTTTCCAGGAGTGTGACTCCGTAGT
GGAGTCCCTTGCACTAACTTTTCAAGCCTCACAAAGCGTAGTACCACCATTTTTTtacctgctgctgtctcaATATCACTTAATGCGGCGATATCCCTGT
GCAACTGCTTTAATTTCCTTGGACAGACCAGGAAGTCCTCCTTGTCCATCCCCACCAAATAGTCGTCTGGTTGGATAGTGTAGATGGACTCACAGGATGT
CTTGCGAGCCACTTTGTCCACGAACTGCATAGGGAAACGTAGTTGTTCACTCACGATTTTCTCCACTTGGAAGACGTGCGAACCCATGAGCGAATTGACT
TTTAAACCAAAGTCGGCGGCTCGTAAAGGGTTGGAAGCTCCAGCGGACGCGTGAGGAACAGTGTAATGTACTTCATAGGCGTGTCCTAACGACAGGAACT
TGCGCACAGCTAACGCTGCCTCCACGCGCCACAGACGCACGCGGAAGTCGAAGGCCAAGGCCTCGAAGTCGGGCGCAGGCTGTGCGGTTACCATGAGCTT
TCCTTACCCTTCGATTGATTTTTGGATGAACgataaaataaataaataaaaaaaggTAAAGTTTATCTCATGTGTACCACACAAAATAGTGAGGCATATC
ATGCGGCAACGAACTTGAAGCTAAACTTAATGATTCGCGACCAAGAAATAGCTCTACCTCCGAATATCCTCATGTTCGAGTTGCTCAACCCGAGACGAAA
AGACAAACATGGTCACTCAGTAGTTCACTGTTGTGTTACTCGTGCTATAGTAATTGCATTTgctgccccccccccccacatACGCATATACGTTCGGCTA
TTACTCCATAAGGAAGATGCGGCTAGCGACGTCGGCGACTAGCCAATCAATGCCGTTCACGAGACCGTCGCCAGTGACAGCGCTGCACGAAACAATATTC
CAGTGGCGAGTGGAGAATTGAGCAGACTTCAGACCCAGAACGTCAGCGATTTCTGCAGAGGACAGAGCCCCCGGTAGATCCTGCTTATTGGCGAAGATCA
GGAGCGTTGCACCTGCTAGTTTCTGTGGCGAGAACGGAAGGTCAGTTACCAAGTAAGGTGCAGTCCAATCTTGTTGTTAAGGTAGCACGGACCTCTTGGG
TGAGAAGACTCACGAGCTCGCGCCTGCAGTCTTCGAGACGTCGTCGATCAGCGCTATCCACCACCCACACAAGGCCATCGGTCTGACGGGCCATGTACCA
ACGCAGCGATAAGTCGACGATCCAGTAGCATTCACATTTGCAAGCCAGAGGCCCTGGGGACGAACCTGCTCAAAGTAGTTTCTCCAGTACGAGCGGATAG
TCTGCTGTCCACCGACGTCCCACACGTTCAGCttaaagctgcagcaagtcgagCAATCACGCAGGACAGCATGTCCACATGTCAGCGAGTCCGGTATCTT
AGCAATTATCACCTCTCCCCCATTCACTCACTCTTTATATTCGAGGGTTTGGATATCGAAACCAAGTGTGGGTGATATCTCTGTAATGTCCTGCCccatg
aacttcttgaggATTGTTGTTTTCCCAGCATTGTCCAGGCCTCTGCAGCCAAACGTATCCATATTCACAGAAAGGATGTAAGCCACAAAAGAAACCTAGC
GCATTTCTTACGAATACGTAGTGGATATACGCACAGCATCAGCACGCGgacctccttctccttttccttgaccttcttgagGATACTCAGCAGCCccatc
ttgttgcttggaCACTTTGGTAACCAAAGTTTGGTTATTCCCAATACAAAGATCAAGTCTAAAATTATGTATCGGATTTATAACCCAAAGCAACCGAAAC
GACGCAGAAGCTGTGCAGTAAGTGGAGGGTGTAATGACGAAGGCGATCCCGCTAAAGCGCTTTCTGTCCGAGCAACGAGATGGgaaccaagaagacgccC
ACGCATTGCAACCCCGCCGTCGCTCGAAACTTCGCCTTCcgttgcagcaacagcccGTTGATTGGGACAAAAGAACGGAGTCAAAGGGTTGCCGACGAAC
GTCATTAGAGAAGTTGCTCGACTTAGAGCTGGACCTGGATTTGATTCTACCTGCAGTCTCTGCTCCAACGAGCAACCAATTTTCTGTGTGTGCCGCAGGA
GATGAACAGGAGTCAGACGTTGACTTCGTCTCCCTTGAATTACTGGTACGTTTGTCAGTTCAATAGACGTTAAATGCTGTGGCTAAATGACGGTACTCGT
TGCTACTGCAGGCGATGCAGAGTCCACACGGTGAAAACCAGCATTGGCAATctgatgaaggcgaagaagatTGCGTCGTGGCCCCGTTGAATCTGGCGTG
TGTGAAATCAGTGAGACCGGAAGATAATTCCCCGAGCCGACAGAAAGAAATTGCGGCCTCCAGAAAAAATATGAAGTTGGACCTCATGTCGCCCACTGAG
TATATTCCGTGCTTCCCTCCGTCGCCCACACTACCGACAACAGACAACGACTACGATTTAGCATCTCCCAAGGCGCTACCGACAACAGACGACTACGATT
TAGCATCACCTATAGCGCTACCAGACACACCATCGCAACCCCGACCGGGGATCGTGTTAGCGTGGAATCTCGCGCCACGTTCTCCTTCCTCCAACAATGC
CAAAAACTATCCTCGTACTCACGTGCAATCCAAGAGCGTCCAAAAATCAGAGCGAATTCAACGAGCTTCAGGTGCGGGAAGAGCTGCCACTCCAAACCCA
CGGAATCATATGAATTTTGTCCCGCCAGAAAAAGTTAACGTGCGTGTGACACGGCGTTCCCTCCCATCGCTTTCAGAGGGCAGAAGTAAAGCCCGGCATG
GAGGAATTTACTCGTTACTGCTAAAGAACAAGTCTGCAGAACAGGAGCCTACGCTTGTAGAGGATACGCATAGTCCAGAAGGTGCATTTCATTTTATCTG
CTTTGCGTTAGAGTATATTCTCATTGTTGTTTTGATATTCTGTACTGTGCTACAGAtacgacaccagcaccatcCATTTCCAAGGTGAGTATATACCCAC
TTTCTCGAATCAttcgtcttcaacaacgAATCTAATCCAATTACACCCTGCCTAGGCTTCCCCATCACACACATCGAGCAAAATAATGCATGGAGGCATC
TACAAAATACTTCGAA