Description :
From Genome Similarity Track
Location :
Scaffold_531:9377- 12569
Sequence
3192 bases(100 bases per row)
GTTGCAGCGAGATTTCGATTCTGAAGGAACCACAGTAGCGCTTGAAAGTCTCACGTCAAAACTGAAACGCGGTCTTGAAGCAGCTGCAAATCACTTCTTT
GACTGTGAGTTTCCCCACGACATTCGCTGCCGGCTGCTTGAGGGGCTTGCACTGCGGGAGGGTGAAGCGGACTGAGAACACTTGCCGACCTTCACGGAAA
AACAGTCTGAGCAAGAACTCAGAAAGTATCTAAAGGAGCTCAGCCGCACGTACTCAAAGCTGACAACGACGCTAGATTATCGATTTTGGGGAACTGAAGT
GACGCTGCGAATGCTCGCCAAAATCCTTCAGAGACaattttttgttgttgtggcgCCAAACGGAATGGCCAGATCCAACTATGAAATGTTCGTACCGGGT
GAGGTGAATGCACGAGGCCAACGATTCTCGTCGGCAAAAGAAAAGACCTACCCAGAAGGCAAACCACGGGAATGGATCAGAGCCCTTCAAAAGGCCTGTA
GAACATCAGGAAAAACAGGAACAAACCCAATTGTCAATATCTTCAACGGCAGCCATTACAACTGGCTTCGTTTTCGTACCGGAGAAGGGGAGGCAATGGA
CATTGTGAACGAcaacccagcagcagctgcaactacAAACTACCAAGAGAACCAAACCAGCAGTAGTGAACCAGAAGATCCAGTTAGTGACACACCAATG
GAAGATGCCCAAGAAACGATCACGAAACAAGAACAAATGGAGACTGAGAAGGTAGTGGAAGTAGGGGGAACAAGACCGAAGGAGCTCCTAACAATCACAA
CAGCGGGTCTCAACGGCCTTCCTCCGGACACAAGACGAGAATTGCGTGAGCTGGATCTCTCAGAAGAAGCCGTGGTTCAAGCTTGGACGCAAAAGTTTGA
AGTCACCGGTCCTCAATTACAAACTTGGCAACAAGAGCTTCAGCGGGAAGGGCAGTTCTCCGTGTACACAACGACAGAGCCGAGTAGTAGCACAGCGGAT
ATGCCCAACTGAACCCCTACACCAATAGAGGAGAGGCAAGAAGACGTCAAGCCGCAATACATTAGCCAAGACAACCCAAGCAGTCATAGAGGTCTCGGGA
GATTCCAAGGGGATCACCAAACTCTAGGAGCTGACAAGATCCGCCAACAAACGCTCAAAATGACGTGGAATGATCTACAAGCGGGGTGATCATCTGCTAC
GGACATACCGTTTCCAAGCATGccggcgacagcagcaaaatggaAGGCAGCAGTCAGAGCTGCACCACGGGAACTACTACAATTACTACAGCAATTCTCG
TCTCCAGATTTCGTTCTCAGCACAATGACGGATGCGACGCCAGATGAATGGACACTGGAAACTAAGCGAGACTGCTTGATAAGCTGTCTCTCAAGACACA
TAACTCCAACCACAGCCCCAGAGTTGAAGACCTGGCTTCAAGAATGGCGAGCCATATTCCAGAGCCAAACGCGTGAAGGTCCTAACTACTTCAACCTGTA
TCCGAAGGAGTTTTGGGAATCTATTAAGGAGCGTGACTACGCTGACTCCGAGCTGCTAAAGCACTGTCGAGAATCAGAGCGGCAAAAACTATCGCGGATG
ATACTAACAGCATACATCTACAGCGCTGAACTGAGGATGTTGACGGGAAAGGATAACGAGCCCCCAAGTACACTGACGGAACATCTCCACTTGCTCTTCG
AAGCCATGGAAACTCAACCCGACTTGAATGCCACGATCCATAAAGCTGACACAGTAGGATGCTGGGCGATACTTGAGACAAAATTTGCACTTctcgcagc
aacaggaaggAACGCGGTCAGCAAGTCGCCAACCCAATTGCAATAAAAATGGTAGAGACCGCGACGGCAGAAACCACGACGGCAGAAACCACGACGACTG
AAGACTACTACGCAGAAATTTCGAGCCCCCAAGCATTGTTTGAAGAATCCACATTCCTacaacgccaacaacgcATCAAGGGATCGAGTATGACGATTGC
ATCGCAAAATCTGCGAGGCTTCGCAAAAAAATCCAGAAGGCGATGGCTCAGTGGTTGGCGACGAAAACATGGACCACCTCCTCCTGAAATCATCCTCGTC
CAAGATACAGCAATACATGAAGACAACGAAGTGCTAGCCATACAAGAAGCGTGGCAACGAACGTGGCACCTGGCCACAACCAAAAGCCCACTTAGctact
ggacgacgacaaacaCAAAAGCTGCAGGTATGGGAATCCTTGTCTCCCCTACAATGAGCGAAAAAAACAGTTCCTTGGCAACAAGACAGGTGGACTTCGC
GCGTCATAGCAGTCGAGttggatggatggatggcTGATTCTTAATATTTACGCTCCCACAACGGACGAGACCAAACGACAATTCTTCCAAGACCTGGAGC
CATGGCTGTCAAGCCACAACTCCATTATCCTGGGAGGGGATTTCAACTGTGTTCTAAGACCACCAAGAGATCGAATAGTAGCAAGACAGCCAAGCACGGC
AAAATGTGAAAGCGTCGAACTTAAGGCTATGCTAGACCGGCACGAACTCACGGATGCATTTGAATTAAGCCACGATCTGGACACCGAGGATGAAGCCGTA
AACCCACTCCATCACTACACGTTTTGGCGAAAGGATGGGGCCAGCAGGCTGGATCGATTTTACGTGAAAGGACTACTATTCACGGCAACCCAATGGGTGG
AGGTGATAGAACCGGCATGCGATTCGGACCATCACGAAGTTCGAATTGTATTCGGCACGGGAGCACCAACATCTCGACCCAGAACTACTCAGTACTATCC
GATTCCAAGTGGAAGACCAGAGCGAATTCAAACAACGCTAGAAGAGAAACTGGTTACCCTTCTCGATCAGTACGACCAGGGCGACCAATCGGTTGCACAC
TGGGACCGCCTCGTTGGCGATATACAAAGTATTCTTCAGGAAACGAAATAAGCTGATCGAAAGCAGACCCAGCGTTATTTCACGAAACTACGTGAAGAGA
CTAGGGTGCAACGAGCGTCACGGAAGGAAATCATAGCCGCTaatgaagctgaagctggggggagagcagcacgctcaTTTGGCAAGCGCATCAGGGGATC
ACCAGATGAAATGAGGCGCTTTTATAAACGAAATTCTGACTGGCAAAGGGATCAGTCAATTTTGTCAATAGATCCATCCCCAGGACACTCCT