Description :
From Genome Similarity Track
Location :
Scaffold_1324:9375- 10734
Sequence
1359 bases(100 bases per row)
AGTCTATTAAGATTCAGTGGCCACGTGAAACGAAATCCTACGTTTAACCCCTCTATGCCATTAAAAATCCCCTTACTCTGCCAATACGGATCGCTTACTC
TGACAATACGGATCGCTGACTTTTGACAATACGGATCGCTTACTCTGACAATACGGATCGCTTTTTTATTTAGCTTAAAATAAACAGAAAAACAAATTAA
ATTGTGTATTCAGTTATTCACTGTCCTGTGCACTCTCCGCCTCACTCTCCCACTCGCTCTCCTCCGCGCTTTCTGCTTCTCCCACCTCCCCACCCTCCTC
TTCCTCGACTTCTTCTTCGCTTGCGTCCTCACTTTCGTCGTCGCTCTCAGCGTCGACCGCATCATCATTATCTACGTAGAAATCATCATCGCTCTTCTCC
TCAATGTTATCACTGTGCTCGACCTCGTCATTCACGCCGTCCTCGTGGTACACGTACGCTAGCTCTTCAGTGTAGCTGGACTTCCCCGGTTTCTTCGGAT
GGCGGCGGTGGTTATGCTGGTACAGCGCGTTTCGCTTCTTGAATTTCCTGTTGCACTTGTGGCAAACCCCCCCCCACGCGCATCAGCTTCTAGGCGCGCT
TTCTTGGACTTGACCTTGTTGGGGTTGTCAGCACAGTAACGGCGGTGGTTGGAGAGATGACGACACGATGTGCACTGTTGGACGCAATGCTCGCACATGT
AGCTTCTGAACACAGCAGCTTCAGTTGCGTCGGCCTTTTGTGAAATTCCACGTACACGTACGTAACAATGCAGCCTCAAATTTTCCTCTTCAAATTCAGC
CCCTGCATGGACCAAGTCTCCGCGGAACAGCAGGAATGCGCCCGCGTCGAGTGACAACAGTTTGCATTTGTCCATTTCTGCATAGACTCCAAAACAGACA
GGATAGACGTAGAACTGTGTGTCTGATTGAAGAGCAATAATGACAGACGCCTGAACAATACCCTTTCCCAGTTTCGCTTTGCTTGTCTCGAATGAAAGAA
AATCTAGGTGGATGCCTTGGCGAAGGCCCCCCGGAAGTGATATCAATGCGTTCCAAATAGACTTTTTGGTGTACCAATTTATATCAGATCCTTCTACAAT
ACCCTTCACTCGCTTGTATATTTTGTTTGTAGCCGGACCAAATGTAGCAATAGGAGCTTGAAGACGGAAATGGTCACGTTCTACTTCATAAACTTCACCA
AAAATAGGTCTGAAGTCCAGTTGCTCGATTTCCTGTTTAGCTTTCTCCAAAGTGTGAGGCGGTAGTCTTAAGTTTCCGACAAGGTAGCCTTCATTCCAGA
ATTGCGCCTTTAGACTGGCATCCATAATGACTGACACCTCGTCACACTTACTGGCCAGG