Description :
From Genome Similarity Track
Location :
contig_7:937342- 938750
Transcript NameFunction/comments
g2684.t1hypothetical protein

Sequence
1408 bases(100 bases per row)
AGCAACCGCGGAAAACTCTTGCTGAAGTCGGCGCCATTCTGCGAGAAGCTGCTCACCTCAAGCGTCAGCTACGATTTCGAGTGCCACCGCAGAACTACCA
GAAGCCAGATCCAGCAGCTCATGAGAACGACAAGTCAAAGCTGTTAACGGGTGCACCAAGTAGCTCAGCGAGCGTTGTGGGGGGCAATGAGACTGGCAAA
CCTACTGGTGAATGGTCTAGCTGGATGAGGGGTGGTCTACGAGCTGCAACCACAATTGCTGCTCCAGCGTCTCGTGTAGCACCCCCAAAGCAACAGGTAC
CACCAGCTTCGCAGCCAACACAAGAGCCGACAGCGCCGTCACTAGCTGTGCCTCCAGCATTGAAGCCAACAGGTAAACCAGCTTCGTTTGTGCGCGTGAC
AGGCTTAGAGGACCGCACACTGAAAGCAGACAAACATCCATTTGTGCCAACCGCGCACGATAAGGTGGTGAGCGTAGAGGTACCACCAGGTTCACTCGGT
CTGCACCTTGACGGCAGCGTTGTAAATCGTGCTGTGGTGCTGGGCTTCATGCCGCTCGCCGATGGCTCTCGCGGCGCACTCGAACGAAGTGGCAGCTTGG
CTTCTGGTGCTGAAATTGTGGAGATTAACGGAGAAGACGTCTCGCAGGAATCTCTAGCTGGAATTCGTGAGCGGTTGGGTCGTAGCAGTGGTGAACCGCG
TCGCCTTAGCTTCCGACTGCCACCTCCGATCAAGCTGGTGGTTCCATTGGTGCCAGACGGTTCCTCGTCGGTAGCAAGTTCGTCAGTAGGCTCGCCACCA
CCAGCAAGTCGGCGGGTATCCACTGCCAGCATGCAGCGCATGAACCTTCTCGCGGCTTCCCAGCCCACGTACTCGGAGGACACGGAACTGCGCCGACGTC
TCGAGCTGAAGTTGGTCATGAGCTTCGATCGCAAAGAGATCAAGTACAAAGAGTGCTGGTTTGCAGTTCATACCGAGTGGATGAATCGCTGGGCGCTTTT
TGTGGGTAAAGGAGGTCCTGAGCCAGGTCTCATAACGAACCACGAGCTATTGGAGCCTGGGTATGCGTCTGGTGAAGACCCGAACCGGGCTGCTTTTGTT
CGGCCAGGGCTTGCGATCACTAAGGACTTCCGCCTTGTGACTCCAATGGTCTGGAGTTTGCTCGTGGCTCTGCATGGAGCAGACAATGCTCCTCCGATTG
CAAGGTTTGGACTAAACATCTACTCAGAAGCACCTGAAGATATTAACGAGATACTGCATGACGCCAAGCCTCAAGCTGTTGGTCTTGCAACCAGTCTTCG
CGAGAAGTGCCAAGTCGAGAACAAGTGAACTACTCGCTATATAAACACCACCCCAGCAAAATCAATACTTTAAGTAAATACTTCGAAGTGCATTACAAGC
GCTTTCGC