Description :
From Genome Similarity Track
Location :
contig_7:937318- 938726
Sequence
1408 bases(100 bases per row)
AGTCGGAATGGACAAGTTCGACTTCGTGGAGCAACCGCGGAAAACTCTTGCTGAAGTCGGCGCCATTCTGCGAGAAGCTGCTCACCTCAAGCGTCAGCTA
CGATTTCGAGTGCCACCGCAGAACTACCAGAAGCCAGATCCAGCAGCTCATGAGAACGACAAGTCAAAGCTGTTAACGGGTGCACCAAGTAGCTCAGCGA
GCGTTGTGGGGGGCAATGAGACTGGCAAACCTACTGGTGAATGGTCTAGCTGGATGAGGGGTGGTCTACGAGCTGCAACCACAATTGCTGCTCCAGCGTC
TCGTGTAGCACCCCCAAAGCAACAGGTACCACCAGCTTCGCAGCCAACACAAGAGCCGACAGCGCCGTCACTAGCTGTGCCTCCAGCATTGAAGCCAACA
GGTAAACCAGCTTCGTTTGTGCGCGTGACAGGCTTAGAGGACCGCACACTGAAAGCAGACAAACATCCATTTGTGCCAACCGCGCACGATAAGGTGGTGA
GCATAGAGGTACCACGAGGTTCACTCGGTCTGCACCTTGACGGCAGCGTTGTAAATCGTGCTGTGGTGCTGGGCTTCATGTCGCTCGCCGATGGCTCTCG
CGGCGCACTCGAACGAAGTGGCAGCTTGGCTTCTGGTGCTGAAATTGTGGAGATTAACGGAGAAGACGTCTCGCAGGAATCTCTAGCTGGAATTCGTGAG
CGGTTGGGTCGTAGCAGTGGTGAACCGCGTCGCCTTAGCTTCCGACTGCCACCTCCGATCAAGCTGGTGGTTCCATTGGTGCCAGACGGTTCCTCGTCGG
TAGCAAGTTCGTCAGTAGGCTCGCCACCACCAGCAAGTCGGCGGGTATCCACTGCCAGCATGCAGCGCATGAACCTTCTCGCGGCTTCCCAGCCCACGTA
CTCAGAGGACACGGAACTGCGCCGACGTCTCGAGCTGAAGTTGGTCATGAGCTTCGATCGCAAAGAGATCAAGTACAAAGAGTGCTGGTTTGCAGTTCAT
ACCGAGTGGATGAATCGCTGGGCGCTTTTTGTGGGTAAAGGAGGTCCTGAGCCAGGTCTCATAACGAACCACGAGCTATTGGAGCCTGGGTATGCGTCTG
GTGAAGACCCGAACCGGGCTGCTTTTGTTCGGCCAGGGCTTGCGATCACTAAGGACTTCCGCCTTGTGACTCCAATGGTCTGGAGTTTGCTCGTGGCTCT
GCATGGAGCAGACAATGCTCCTCCGATTGCAAGGTTTGGACTAAACATCTACTCAGAAGCACCTGAAGATATTAACGAGATACTGCATGACGCCAAGCCT
CAAGCTGTTGGTCTTGCAACCAGTCTTCGCGAGAAGTGCCAAGTCGAGAACAAGTGAACTACTCGCTATATAAACACCACCCCAGCAAAATCAATACTTT
AAGTAAAT