Description :
From Genome Similarity Track
Location :
Scaffold_7:937284- 944521
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05322hypothetical protein
Phypa_INRA-310PPTG_05323hypothetical protein
Phypa_INRA-310PPTG_05324HECT E3 ubiquitin ligase
Phypa_INRA-310PPTG_05325C2 domain-containing protein
Phypa_INRA-310PPTG_05326hypothetical protein

Sequence
7237 bases(100 bases per row)
ACTACTTGAAGTGGTTGTTTACTTTTGGGATAATTTTTAAAATCTCCCCTCGTATAGCATTTTCAGAAACAGTCAATCACGTCGCTGACATTCGCCGTTA
CACAAAAAGTGGAAGGTAGGTGGATTAAAACGTTAAAACTCGTATAAACGTAACTTGGCATCTAGAATTGTGCTGAGGTTGTACTTTTAGCGGTCAGTTT
TTCCACTCTCCGATGGTACCTAATAATTAGGAGGTCACAAAAGCGGGGTGTCCGGCACTGTAAACTGATCTCTTTCTCTTATATTGGCACCCAACCTTAT
TGGTAAAAACACATTTTTCTTTCATCCAATAGAATCGCATAGTGGTGTGGTACTTTTTAGCAAATCAGATTGGACCCCCTCGTAACAAAGCACAGGGCCC
GGCAGACAGCAGCGGAGGATACGGCTATGGCGTCAGGTGATGCCGAGAAGCACGAGCTAAACGAGCCCTGGGCTATCTGGGAGCAGCGCGAGCAAGGGAA
GAATATGTCGTATGGCGACAAACTCTTCAAGCTCTGTACCTTCAGCACTGTGGAGGAGTTCTGGGGCTACTGGAACAATATCCCGTCACCCAGGTGGGTG
AGCCAGAGTCATGCTGAAATCCATACAACTATGCTTAACACAAGCTCCGTATCGTGCTATGCTATGTGCTCTTCGAGCAGCCAAGTACTGTTTGACGGCT
TCACGCGCAAGAAATTCGCGGATCGAACGGTAGAGGGCTTCGCAGTTTTCAAGGAAGGCATCGTGCCTGAGTGGGAAGACCCAGAGAACAAGAATGGCGG
CGAGTGGTCCATCCGGAAAGGTTCGTGCCGTGGTGCCATGAGGTGTACACGCTGGAGTAATTAATAATTGTTGACTGTTAGAGGTGGGAGCCCAGGAACT
GGACGAGTTTTGGGAAAAGCTAGTGCTAGGAGCTATTGGAGAGCTCATTGACCCGGGCAACGAGGTGACGGGCGTTCGAGTTATCCACAAGGTATGTGTA
TTGAACTTAGTGCCGTTGTGGTGAATGATCTGACACTTTCGCTATATCAACAGAACAACAAAAAAGACAAGAAGGACTCTGGCAACAACTATCGCTATGA
AATCTGGCTGCGAGGCTTAAGCCGCGCCAAGGCCGATGAGATCCGCAACAGGACGATGGACGTGGTCAACTCGGGCAGTTCTGGGGCGCCCTGGGTGTCC
AATGAGTTTGTGTACAAGAAGCACTAAGTGTAACCGCCACAGATCGACCGCGCGCGCTGCTGTGATGTGATGCCGACACAAAAGGATGCACACCAGCAGG
CTGCCATTTTGTCCAGAACCTGGGATATTCAGCACCAAGCGCAGCAATCGATCGAGACAGAGAAAGTAGGGTAGAAACATGACAGAAGAACGCTGCGAGA
TGGCAAATCTGTGAGCACTTTTCAGTCAAGATAAAAAGAAGAAGAAATACAAGTAAATAGAGAACAGAACAGTGGATGTCCAGTGCGAACTTAAGGCGAA
CCTAACACTCAATCGACAATTCGTTGTCAATCATGGCCGCTAGCAAGGTTAAGATGCTCTTCTCGGACGCTCCTCCGGACGCGCTCGAGTGCGTACAACA
CGTTTGCTGCGTCTGATCACCTAGTGTTATATCTCATATAAGTGTGTTATCTCTTTTTGCGCGGCAGGAAGCTGCTGTCTCCGAAGCGAAAGCTCCTGTA
CGGACTGTTCGCCTTTGGCCCTGGCACGGTGTTGGGGCTGTATCTGTACTCTGTGAAGCGAGAGATGGAGCGAGAAAATGAAGTCCTGCGTCTGAAGCAG
GTCGAGAGCGAGCTGAGTGTCGTTCAGGAGCGCCAGGACAAAGATCTGGTGCTAGCTTCAGCGATTCAGGAGATGCGCGACCGTCTCCGACGACTAGAGG
CGGAGGCTATTGCCAGTCGAGAACACGCTGCCACGGTAGCGAGTGCTGCTGACAGTAAGACAAATAACAAGGAGGTAGGGACACCGACGGTAGCATCAGT
ATCAAGTGAGAACAAGATCGATGCAGCGTTGGCCGTGCTAACGGCCAAGGAGAAGCCTCAAGAGCAGAATGAGGAATCGCCTAGTTGGCTCACCTCGTCG
TTGGACGGTGCTCAGGGACGCAGAGATAAACGCCATCAGGAAATGTTGCAAGGGGATATTGCAGCGTATATCGCCAAGCAAAAAGAGCAGGCTAAGTAAT
GCGAAGATGGTGTTGATAACTCGCTACTCCTCGCGAGGTGTTATTTACATTGATTAATTCGCATCCAGGACTTACTCGAGACCAAAGCCGAAGACCTCCA
TTTGAGAGACCATAGTCAAGTACGTTTCCAGCTCCTCCATGTCACGATACATAGGTAAGTCGAGTCGATTGAAGCAGGTGTGTGCCTTGGGGAACAAGTC
GGATTTCTCCTTACCTCGTGACACGAACTGGATCGTGAACTCATGAATAATCCCACTAGAGCTCATTAGTCCGCGGAAACCTTCCACAGGCACACGACTG
GTACCGGTGACAAACTGCAGAAGCTTCGCACGCTCCTCTGGAGCCAGACCTTCGACAACGATCCAAAACCACTCCAGTACTCCATTCTGCTCTTCTACCG
TGATCTTTCCCTTCCTATTCTCCTCGGGTTTAATGTAGCGAACATGAGTGTGTGTTCTCCAATCCGCAGTATCGATAGTGGGGATGCCACACAGAATAAG
CTCAAGCTCCTGGTAGTCGAAGACAGATAGCAAGGCCTTGGGAACCACGTCGTAGATACCCATGAGGAATTCCTGGAGTTGGTCAGCAATACTGTCAAGC
ATGCGGTGTTCGAGAATAAGGCGTAGATATTCCTCCTTGTTTTCATCAGTTACGTCGATGTTGCGTCCATTTTCCTTGAGATCCACCTCGGTACCGTTCT
CAAGCATCACACTAAACGTCAAACATAGCGCCTCAACGTGATTGTTGCTACGTAGCCACTTGCAGTTCCGGTGCAGCTCTTCATCGAGGAATTCAAGATC
CGAGAACGAAATCGGAATACCCAGCACATGTTTCAGTAGTGGCAGAGCCAAGTGCACATCCAGTACGAGGCCCTCGAAAAGCGCCTTGCCGATCAAGATA
CCAGCAAGACGGAACAGCTTCAAGTGGCTCTCGTTCTTCTCGCCAGAAAGCGGATCGATCCAATAGCTCATGTCTTCGCCTTTCGTGGGGACGAAAAGAC
CCATTTTCTCACTGAAAATCTCCTTGCAGACTATTCCAAACCACTCACGCAGCAACCCTCCCGCGTCGATACCAGGCTCTCCTTCAAAGGTGATTTTCAG
ATACGCATGAAGCGCATCGGGTGCTGCCTCAGCGAGCTGCAAAGACTGCTGGATAATCCGCTCTCTCGTCACCGCTACATTCAATCAAACAAGTCAGATT
TGATCTTATCGAGGCGAACAAACGAGCGCACGTACTTAGCTTAGCGACGGCTTCGGTCACGGGAGTGGCAATGCGGGACAATTGCACCAAGAACCACTGC
TTTTTCATTCGGAAACTAAGAGCCATAACGCCCTACAGATCACAAAACAAGTGAGAAGTTAGTACCTTGAAACACGACTAATACATCGTCCAGGTGTACT
CACTTCGAAGTCCATTTTCTCCAATCCGTTGCGCATCTTGTCAAACGATTCCATGTCAATGGACACCTCATCTGCCTTGGTCCACGTCAAGCGTCCGGAA
GCGTCGTACATTGACACAAAGCCCTGCGAGCGTAGATTGTGGTAATCCGTGACACTCTCTCCGTTCGGTCCAGCCAGCGACTTTGCTTCCGTCGACTGTA
GTGTCGGCTGTGCAGCATCTCCATCTTGCAATTCAGGTACAGGATCCACCACGTCGGTGCTGTTCTGTCGGACCCAATGAAATTTGCCATCCGACATTTG
TTTCCGTTGCCAGAGGCGTCGTCGGAACGCTCCCCGTTGTCGCTGCGATAGGTTCTTCCTGGCCGCCATCATGTTCATTCGACGCTTGAACAGCGCGCGC
TGTCGAGACCTCAAAGCCTCAATATCCTCCTCTTCTCCGGCCCCGCCAGCCATATCAGCTCCCATGATACTACGACTGTTGTTACGCAGTAGCATCCGAG
AGCTTTTGCGGCGACCCAGCTCTCCGGTCATGAGGAATCCGATGCTGGTGCCGCACATGAGGCAAGTTTTGCGTTTGGCACTGTTGGCCAGACCACATAC
GACGCATTGCCAGCCTTTGCCCTCGTCCTCGAGCTCCGTCTCCTCGAGTTGATCGCGCCGCAATAGCCCGTCCATGAGCTCCGATTGCGCGGTGGAGTTC
TTACGATAGCAGCACATGTAGACGATGATGGCCACAGCCACAACGGCGGCCACGCCTAACATGATACCGATCCATTTTACGGCTGACACGACGCTATCGA
CGTCGCCGGCCTGGGACGACATGTGTGATGTTCACGTTAATAGGAGGGAATTGCTGAATGGAGTGAGGTCAGCAGCGTAATCGCCAATGGCAAGAAGCAC
ATAAGCACGCAACTACATGTTGACTTGGATAAAGTAAGTCGCGACTAAGTGCGAGATGTAGTGGAGGGTCGACGTGAGTCACGTGGCATGTCAAAGCGAC
AAGTTGAAGTGCATACTGAAGTGACTGGATCACAACGGACACTAAGCTTTCAGTGGAGCGACTGCGCCAGTTGCAAAGCGCACCTCGATCTCCGATGCTA
GCAAAGCGATACTCAGCGATGATCAAGAAACGTGTTCATGAATTTCGTACGAGACTGTTGGGGCCACTGCTGTATTCGCGGTGGTGTTGGATGGTCTCCA
TGCAACCAGGGGGGGGGGGGCCATCTGATTAGATTCTGACCGCCAATACGGCTCTCGTTGCTCCAAATTTTTGTAAAATTCGCGTACATGACGTCCTTCC
AGCCTCGTGGATATCTTATGCTGGCCGTGGCGTCGTGACGTACCAAAGACCGGAGCCGGGCCGCCAGAGGGTCTATTACAATGCAAAATCTAGTTGACCG
CTGGGGTTAACACGATGGTATTGCTGTCTGCAGCTGGTAAAGAGAGAGAAAGTGATCGCAGTTGGGTTCTCATCGTCATGACAATTGTAATGGTCCGCCG
CCGTGTGCCAGGCCAGGTGTCAGCAACAGAAAATGTACCCACGAGATCATGATTCCCTGGATTTAAAAACCATATCATTTCGTTCAAAACCTGCAAAAAG
TTCAGCTACAATGCACAGTCCGTATTTATCCTTGTCCATATTCTACGTCATCCTTATCTGGATTCTCTCATTGCTTTACCGCCACGACAGATCGCACTCT
GCATTTGTCTCCAAGCACCGCATTCCTCATACGACCATGCCGTTCCTGCACGTGACCTTACGTGGCGCCACGGACCTGCCCTCCAGCGACTTCAGCCTCG
TGGGTGGCAAGAGTGACCCGTACGTGATCTTCAAGCTCAACGGCACCAAACACCGCAGCCCGTGTCTTAAGAACACGCTCAACCCCGTGTGGGACCCTCC
TGAGCACTACGTCTTCCCTGTTTCCGACGCTGCCAGTGCTGTGCTTAACGTAGAGGTCTATGACATGGACACACTGAACCCGGACGACCTGCTGGGCACG
CTCGTGGTGCCTGTGGCCAAGTTTGCGGACGAAATGGAGGTGTCAACACTCGAGAACTACCCACTCTCGGTGGCCAGCGAGTTCTCGAGCCAGAAGCGCA
ACAGCACGCTGCTATTGGAGATTTGCCTTAAAGAAGTGGACGATCAGGAGCGTCGCGTATATGTGTGGGAGAATGAGAGCTGGTCTATGGGCAACGGCTG
GAAACCCACCAACAACTCGGAGCGGCGCCAATGGTCGGCCTACGACGACTCGGCCACCTCCGCCACCTTCTCTGAGGTGGCTCCGCGTGCGCCCGCCAAT
ATGACTGGATCGGGCTGGCAATACTGCTCCAATCGCGGAGACTCGCAGGGCTGGTCGTACGCCAAGACTTTTGCAGGCCCCTGGACACCAAACAAACCAG
CGTTCAGCTTCGTTCGACGTCGTCTGTGGGAAAACACGTTCAAGCGTGAAAGTGACTGAAAGAAGAGTTGAATGTATGAATGTTGCATGATGATATTTGG
CCCAGTACTAGCTAAGGCCATCTAAGAAATGTATTAACGTTATTACTGCGTGTATTAATGTCCAAAGAGGTCGATCCATTATTGATCACAGTTGAATCGA
CGCTAGCCAGGAAACGGATTCGGTCATGCCCTTGGAGCAATCGGAATCGCAGGAGCTTGAGCAGCATGTTGAAGATCCTAAGACGGCCGAGAACCACACC
GAGGAAGAACTGAATGGAACAAATACTGACGATGTCGTTCGCAGTGCTCGAGCAGGTGAAGATACTGCCGCTGCAAGTGGAAATGCGTTGAAACTAGCGT
GGACGTTTGGCTTCCAGAAAGACTTGATCAGTGGGGTGCATAGTTTGTCAGCTGGAACTCGCCGTGCTGTGTTCTATGCAGCAGCACACACGGGTGTCAT
CTATGACTACGCTCGTCGCCAGCAACGACTGTTACAAGGCCATTGCCACCCTATTTCCTGCTGTGTTGTCAGTGAGGACAAACGCTGGGTTGTCACGGCT
GATCGCGGCCAAGAGTCAATGCTCGTAGTGTGGGACGCTCAGTCGGGCAACCCAATTCGAACTATCTTTCGACCGCATGCCAACGGTGTCCAAGCTATCG
ACATCTCACCAGACGCGCTCTTTCTCGTTACTTTGAGTGCCGTCGACCGTGACGATGAAGATGCTAGTGATACTAGCAAGAGCAAAACCTCTCGTAAGCG
GTTCGATCAAGAGTTAGCGGTATGGGAGTGGGCAGCTCCAGTTAGTGGAGCTGCAGTCTCCAAGCCTTTGTACTCGTCCCTGGTAGCCACAGAGGACGTG
CAGCACGCTGTGCGGTTCAACACCTACGATGTTAGGGAACTAGTCACTACCGGTCGCCAACGTGTCATCTTCTGGAGCTGGGCGGCTCGCACTCTGCTGT
TCTACTCTCCTTCGCTGGCACAGAAAGACTTCCGCCAGATTGTTGGTGCCTTCACGCAGTCACTCTTCGTACCCGACTCAGCTCAAGCTCTTACAGGTAC
AGAAGATGGCGATCTTGTGCTTTGGGATGCAGTTCAAGCTGATACCGACGCTGAGACTGCGTCGACCAGCTTTCCTGAACGTAAAGCAGTCAAGATCGTA
CGTCTTGCAGGCGGGGCTGAGCCTCAACATAAAGTGG