Description :
From Genome Similarity Track
Location :
Scaffold_328:9371- 11004
Sequence
1633 bases(100 bases per row)
GCGATTGTTCTGTCATTACGATGTGTCAAAAGAGGCCTACTCAATCAAATAGAAATATTTGCCGTTTAATTGTAAGTCCGAAAGGTGAAGCTATTAGTGA
CTGTGCACACGGTGAATGCCGAACTTTTCAAATTATATGTCTGTGATATTTAAATAACGCGGCTATGTGTACCTTAAACGGTCTAAGTGCAATCTAGCCT
GTCCCCCCTCATAGGTATATATGCATATACAAAGTCACTCTTGACTAGGTTACTATTGTGGTGACGTACGTGATTGGATTATAATCGATCAAAGGTAAAT
ATGATCACATAATCACAGGCTGATCGCGTTGTCCTAGCATACTATACTGGATTACTACATCAATTAAGAGCATCATAATCATTCTTCAGTGAGTGATGTT
GTATAGCGTTTTGCATCTTGATTCAGTTCTTCAAACTGGATTCCTTATATCGAACGGCGAGCTCCAGATCTTGCTCCCATAACTTTTACTACTGCAGTTA
GGTTGAGCATTAAATCGAAAGTGCAACTATTCTCAAACTTGCAACGATCTACAGATCGAAGTACTTACATATCCGCTATTTATTACAAGCCCGAAGTATA
ACGGGGCACTGGGCGCTTGTACTGTCACAGTACAAGCTGATTACACTGAACACAGAGTAAGTAGGTGCCTCGAAACTTCACTTACACGCGTCGCGTAGAG
GAAGGTTTCAATACGAGATAAGGGTAAAAGTAGAACTGTATTTAGTATAATTAATCTCCTGTTAATAAATCCTATTTGGTCTTCTTTTAACTAAATACAA
ACATGTATTGTAACTAGTTGCTCACCACTCGTTGCGTTCTTCTGTCGTAGCTTGGCTTTATCGGCTGATAACATTGTCATTTATCAACCAATGAACAGTG
TATTACTTGTGCATCACAATATTACTTGTTAAGCGAATACTGTAAGAATATGATGTCTGTCTTAACATAATGTTCATACTTGGTACTTACTTTATGTAAA
GTATCATGTAACGAAGGCATTCCATTACATCATCTACTCTCTTAACAATCAGTCATAGTAGTGATTTATTGATGATTGAGTGGCTCCACTGAGTGACTCT
GGGACAGATGAGCACTTATTGGTTCATTCCCCGTTCTCATCGCATGGTTAACAACGCCATGCGGTGCGCGGCCAAATCTGCCGGGAGTGCAGCAATGAGA
TTTGTTCTGCAGTTCCGGAAGAGGCAAAGATTTCAAATGCATCAGGTGACACCCCGACTGCTGCTTCCTCTACTCAGCCTGCAGCAGTCGCTGCTGTAGG
CTCACGCAGTGATGTACCGCGTGACATCGGAGATTATGAGCTCGAGCTCATATATTCCGGCGGGTCGGATTGCGGCAACGACTCGAAGAAGAAAGTTGCG
AAGATAGAGCCAGACGTGACCAAGTCGGAGTCGACCAAGTCGGACTCGCGAAGCGCTATGAGCCTTGTTAAGCGTCGTGACATCGTCGGATCGTCCGACG
CATCGGACGATTCGTCTTCAAGACGGAGTTGTTCGCTCTAGAGTGATCGAGGTGGTGGCTTTGGCCAGTTCAATGATATGGAGGGTGCGGTGCGTCACGA
TCAAGACGATAGTAATGGTCGTGGCGTTGGTAC