Description :
From Genome Similarity Track
Location :
Scaffold_2186:937- 2683
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2186-snap-gene-0.1Gene of unknown function

Sequence
1746 bases(100 bases per row)
TTCCCGCTTGTGACTATGTGTGCAGATGCAGCGACGTTGGTGATGATTACAGTGATGCTGGTTCAACTGTACCTCCCAGACTAGATAAGTACCATGCCAG
TGCCTTTCTCAGCTCCCCACTTGCAGTGCATTGAATATCAGCATGCAGTGTTATGTGAGCAGTTAAATATATTGTCGTGAACTTCGTGAGAGGTCCAACT
CAGTTGTGCTGACAATGTGTGACAACACATCAATTGTACAAGCGGTGAAGCGTTAATGGCTCATAAAATTTCTTCCGATGAATCGTGCACTCAAATCAGG
GTTTTCTCCCCAAATCTGTCCTTCGTTATCGCCGTTTTGCCGTACCAACAAGATCGCGCTATGTTACTCGGACTTGGGAGTCGATTTTCGCTCGTTGAGT
CTCGATTGGGCGGTTCTCTGACCACACGACGGTGGAAAACAATGTTCATATCCGCAGGAGAGTTTCGAAGACATGCAATGTATAACTAGTGTGAACGAGC
TTAAAAGTATCTCTCTCAAAAATAATAACTAAATAAAGAACACGCTACTCTGACTGATAAAGGCGCATGGTAATTTCATGTTACTTGTCGAAGCTCCAAC
ATTGTTGAGGAACTTCATGATGACTTGCGATATTTGAAGGCTAAGAGAGGCAAAATCACAAACCAGTCTGGATTATTTCAGCTCAACTGGACAAGGAACA
ACTCGCACATCGTCATTGATGGCTAGTCCTCGATGCTTATTAGCTTTTTGGCAGGTCGTATTCAGATCAGGTCTCAGGTGAGTTCTGAGCGATATTTTTA
AGCTTTTGCACATGATCACAACTTTGGTCTGGTCAAGGTATGTTCCGATCTTCGCTCTGCAAATCCTGAGTCGATGAAATATCGCATGAAATCCATCTGC
CATATATCATCTACGCGATAATTCAACACAACACAAGTCTATTCAAAGTGCCGAAGGAGCGAGAAACGACCGTTCACTTTTTTTTCGCATGCTGAAGAAA
AAAAGACGCCCTTTTACACTCAGTCTGCCACACTCGCCAAAACGCGCGTCCAGAGCAACATCGACCACCTTGTCTACAGAAACACCAACCACCTCCCATC
CATCACAATGCGCCTAGACGCAGCAATTTCGACTCAATCGTCCTCCTCAAGCGTAGTCTCGGTAGCTGGCAACACGTTGACCACACCTAATGCACCCATG
ACATAGGCACGTCGTGCTTCAGAGCGAGCAGTACGCAGCCGTGCCGCCATACCAGTTCCGGCAGGTCGCACAGCGAGGACGCCGATGGGCGTCTACGGTG
GCACCAATCGTGTTTTCCAAGCTCGTGTCCGAGTGCACCACGATGCTTGAGCTCCTACTGCAGCTTATCGTGAAGCTGATGGCAATGCCCAATGCGCTCC
TCTTGAACTGTCGCACTGAATGGACCTTTGATGCTGGTAAAGCTCTATTCCATGTTTGCACATGCCACCGGCCATGTCACCAGATCATCACCTGCCAGCT
GCGACACGTCTCGCTCTGAGCCATCACCAACTTCCGAATGTTCGCGCCTCGGGTCTTCAGGATGGGCTCTAGCATTGCGAGCGTCGCTCTTCATGGCCAA
CATATTCGGCCTGCTTCTGCCACTGGAGGGGACGGTATTCTTCAGTCTTGGCGCTGCAAGCGGTGGCGACGGGGGCCTCTTCAAGATGGCTTTCGGGTCT
GTGTACACCGGGCGTTCTACTGCGGGTGGCAGGTTCGAGTTGATCC