Description :
From Genome Similarity Track
Location :
Scaffold_1192:937- 2110
Sequence
1173 bases(100 bases per row)
CAGCTACGCGCTGCTCGTCATGAGCTCGTGGGGTAGCTTTCCTACCCTTTCTGATGCATCTAGAACGCAGCAAACCGGATAGGGGGATGCTTGAAGAGTC
TTCACTGAAGACCGACAGTGCACCGGAAGTTCCGGTGCAATGCATGATCCGCAACTGAGGCGAATTGCTGCAGGGAGGGGGATGGGGAGGAGAGGAGCAG
CAGGAGGAGCTCCGCTCCGTCTCGGTTGACGAGTGGCCCAGCGCTCATGCTACTGCCGCGCATCCTTCCTCCTTCAGTATTAACATGCGAGGCGGCAAGC
CCATCCGGAATAGCGGCAGCGCCCATCGCCCACTGTGAATACGGACAAGGCCAGCAGGTTCATGCTCCCGTAATGCGGACTTGCCATCCCCGACTGTAAT
GAGGACATTTTCAGCTGCGGAGGCTTCCGTGTTGTGCCCGCTCTTTGACTTCATGTGGTTGTCCGTATCTTGGCGAGTCGCTGCTATAACAACGCACACA
TGGCAGGGACATGAGCTAACAAAACCCCGCTTTCATCTAATCTCTGGCACTTGAGCCAAGTCGGCTCGAACTTCGAGCGCTTGTGCGACCGAGGTAGCTG
CTCTGCACGTCCACATGCGCCAGAGCCGCTGAAGTGCCCCCCGCGCTTGAACACCAAGTTGGAGTTCGTCGCTCGGGCACCGACAGGAGACAAGCTGGCA
GTGGATCGGACAACAAACGCAGTCTTTCGCGAGCCGAGCCGCGCGGAGCTGTAACTCGCTCACTTTTGAATTCACCTTCTCCCGGAGAAGTCCAGCCAGC
CCCGCAGTACCTCGTCACCGCCTCGCAAGCCGCACTTCCCCCGCCGATCCATTTCAAGATGACGTCCGGCGGTAGCGGCAAGACCGCCTTCTTCACGATG
GAGGACGCCAAGGCGTCGTTCAACCTCTTCTGCTGCGTGTGCGGCATCGGTTCGCTGGCCATGCCGTCCAACTACGCGCGCGCCGGTCCGTACTTCGCGT
CCATCGCGCTGGCCTTCATGATCTTCGCCAACACGTACGCGACGCTCAAGCTGTCCAAGGTGATGCTGGTGGCGCCGTCGTCCGTCAGGACGTACGGTGA
CCTGGGCGAGTGGGCGCTGGGCAAGTAACGGTCGCTTCTTCACGGTCGTCTCGCAGATGGGCGTGTGTCTGCT