Description :
From Genome Similarity Track
Location :
scaffold_945:9366- 10708
Sequence
1342 bases(100 bases per row)
CGTGAGCGGAGAGCATTTGTAGCTTGAAGCAGTGTCGGTGGACGTCCCTCTCTTGTTGGTAAATCAAATTGCTCCACCAGTTCTCGATGTGTCATAGCCA
CACCCATTAGTAATAAACGAGCCATCTCATCATCGGTGATAGCGTGTTCAGTGCCAACATTCCTCAGCTGTTGTCGCAATTGTGTCATTGTTCTCAAGTA
GTCTTGTCATCAACTGATCCGGCTGATGCGTGCATTGGTAGAGTTGGCGTCGTAATAAGACCGCGTATGAAAAGTCACGCTGTGTGTAATCGGACACTAG
TAATTCCCACATTTCTGCCGCTGTTGCCATTCCACACACTTTCGATGCGTCATCGCTTTTCCGACCGCCACGCAACCCACGCAATATAGTAGCCCGTGCC
AGTCGATCACGTCTGTCAAATTCAGCTTGCTCGTTCTCCCCGACTACCGGCCGCGTCTCGACGCCTGTCAGTATATTCCATGCGTTTCGTTCATCCAAGT
AGAGCTCCAATTCAGCTTGATACAGCTCAAATGTTCCCTCAAACAGCGGTGGTTTGGTGCTTCCGCGTAATGTAGTCACCGCCGCTCCTCCTGCACCATC
AGCGCCTCCTCCAGCTCCGCGATCACCCATGACTTCAATCTTTTGATGTTTGAATTAAACACTTCACCAATGTAAGTCCTTGGGCTCATAACCTAATAGC
TATTGCGCTGTAAGGAATTACTTAACGTAGTGAAGTATAGATTGTAATGCGAATGCTTGTGTAGTTGAGAGTAAAACTCTGAATGAATTATTAGCTGGCC
ATGCCTGCACTGCATGCCTTATCACGTGCCTACGCACGAGGAGGAAAGCATCACGCCCAAAACTCCCTTTGACTACACATCAATCTGTGAGCCGATTCTC
AGCAGTACTGAGACCTGACCATGACCGTGAGTGACCACGAGAGAAGTTGTGAGACTACATCACAGTAGAGTTCTCATAAGCAATGGTGATCCAAGTGGTT
GTTCAGCAATTTTTCAGCAATATTACCACCCGAAATCCGCCGGTCACGGCGGTCACTGCTTCACTTCGTTCCGGCCAGATGGCAAGTCTCCATCAGTTGC
TTCGACTATAGTGGCAAAGAGAGAAAGGTGTCGTGTCCAGAAAACTGGGAGTTTTAGGAGTTCAGATATTCATGGGCCCATCGCTTGTTAGAAAAAAACC
TCGGAATGTTGCAGACGTAGTTGTAGAGTTCGCGTGGAGACTCACGAATGAACTGCAGTCTAAAAGCTATGCGCGAATGCGTGACCAACTTATGAATTAT
GCGCCAGTGGCAATTTATCCGTAGCATACTCGGATTTTATCC