Description :
From Genome Similarity Track
Location :
Scaffold_609:9365- 12779
Sequence
3414 bases(100 bases per row)
TTATAAACATTTTACCGGCATTTTGTCATTTACCTGCTTTACAGTGTAAAGCTTGTCGCACAGTTTCGTACTGATTAACGAAGTGCTTAGGAGTACCCCG
AAGTCAAACTGTAGCACATCACGCAATTGTGATAGCGTGTACTGGCAGTTGTATTCGAGAtactccaccagcgcctcCCCCATCGCCGGCGTGCACTTTG
TGCTTGCGTCCCAcctctcttcttcacgtcgggTGACCCACGGTTGACGATGTTACGGGCAGTATCGGCGGGATGCCGTTGCAGTCAGCAACTAGCATCC
AATCCCGCCCGGCTCTGTGGACATTGAGAACGCGCATGCGGGTAGTCAGAGTGTGCTTCGGGTCTTTTGGCATGCTGCCGTGGGGGTGATTTCGCTACCG
GCCACCAATTTGCACTGTACTAAATCCACATTGATCTGAATCCTATTTTTTGAATGTACTAAATGCCCTGTGTAGCCcggaaagctctggatatttGTTT
TGTTCTGGTAAATTTGAGTTAGGCTTTCATCAGCGAGGTACGAAAGCGTATGCGTGTTACCCAGTATATCCTCTGCTCCACCGAAACTCCAACCGAATAA
TGTTGCATgaatgctgcacgaatgcCACTTGTTTAGTGAGGTTGCACGAAgccgttcttgtccgactgggtcaacattaCCCCATTTTACTATAGGATAT
GACAGTGAATAAGTTTTAACTCAATTTAGTTTTGTAACTCACGTCGATTTAAGTTTACCAAAATAACGAACGTATCCAAATATACGTTTATAGAAGGTAG
ACGACGGTTTTCGAATGCACccaaactctggatataCATGTccatattttttttattttctGGGTTAGTTCAGCTACCTCACTCAATTTTGCTTTGCACT
AGTGCCAACTTGGGCTGGCAAGATGTAGAGGCAAGTATCTGCAGCATGGAAGCTTAGGAGCTTGATCGATGTCGAGCCTTTATTTAAGTTTGATGGAAGC
TTAGTATGAGGAGACAGTAAGGAGTAAgagatgacgatgctgaaTCTTCTCTCATTCTGGAATCAACACAAAAGCCTCAAGTGAGTTTTCTTCTACTGCT
TTGGCCAAGTGCTACCAAATCGCACTTTAGCCTGAACTCGAGTAGTGAGCTCAGATAAAGGTGTGCCAATTCATGACCACTTGTTTCCGAGACGCAGGGC
GACGAATTATACCTCCTCGAAAGAGAAAACGTCAGAGACCGAATATAAGCACGTCACCACCATTGCTCATCGAAAAGAAGCCTGTCACTCAAGGCATCAA
GACAAAGCCATCAAGTTCATGAAAGGCGATGTGAAGGGCGCTTTCCGGCATCTAATGCTACCAAGCGATCATGTACGATGAATGGCGGCAATGCTCCCAG
CGTTGGTCGTGGGGGGTCGCCAACATGTTGGCTCCATTGGGCTGGACAAGTTCACCGGCGTTACTTGGCGGACTTCGTGGTTAATTGGGCGAGAAAGCCC
TGCGTCAATGACCGATCACTCGGAAGATAACGACCCATTCTTTGCGTACGAATCGGTCGATAACCAAGTGCTAGTAGAACTAGACATCAGCGCCAGACTG
AAATTAACCAATCAAACGCACAGGCCCCCAATGCTGACAGTATTGGGCCCTACTGAGATCAATGAGGGAAACAAATTGCCTGGTAGTCAAAAGTTCATGT
ACTGGGACTCGCGTTTATAACAAGTGCGTGGAAAATGTCGATGTACATTGGAAAAATCGAGAAGGCTCTCGGTCGATTCCGGTCACTCCAAAACAAGAGA
CAAACAATACCGACAGAGCTACAAGAATTATTAGGTAACCTAGGTCACGTGTTTCCGTATCTTTGGGCAGCCAAACTTTTCGATCAACAATTGCACGCAG
TATGCGTTTGAGCGCCGCGGTACGGCAACGTCCTGATTTTTAAGCACATGACGTAGGCTTACCAACCGGGACTTTGATAGGCCCTATGCTTCAGAACTTA
AAATGGTTCGAGATGATTAAAGCCAACGGCCGACTTTAACAACTACCGCTGGCAATGTACGCCAACGTCAAGCCCATCGTCGTTCATCTATACATGGCCG
CGAACAATAGCGGTTTTGCTGTTCTCAACCCAGCCACATGACCGTACATCCAACTGCaattgacgaagacgagtaTGAATGGATTCGCGCAACACCAGGC
CCTGATGGCTTTAACATCAACATATTAGTATAACAATGTGTGGCTCTTGTAGCGTGGTGTTTTGGTCCAGGAAAGTGGTTGTGCTCCAAACCAGTGCATC
TCCGTTTATTCATTTATCCGTCGAACATAAACACTGCGCCCAACGTGCAAACGATTCCCGCGAATcgcggtagggttcatgtCTTTCTACTAAGGGTGtt
tgggtccgcgcggaACGCCAGTAGTGTGATAGTTTTCTAGGGTTctacaactcatatttaCCAGAGCGTATACACTAGGTCATTTAGGGAGTTCGTTGGC
ACCTTGACCAATAGCGCATCTTTGGCGTGAAACCATATTTCCTCACAAAACCACGTTAAAACACATGGGAGCCTTACACCAGCGAAAGACTAGGTAATTC
GGGAGAAAGTACCGCTTTTCGTGTGCGGAACAATCTCTCAAGTGACGTGATGCAACATCATGGATGTTAGGATTTCACAAATATCTAGAGTTTGCGAGCT
CGCAAGACATCAAAATCATTACTCCTAGTACGCCTGAGAACATTGTGTCAGTGCGTCTTCGCTTGCATCTTGCTCTCCTCCCAGGTAATCAATAGAGATT
TCAAGGcagcgcttcttcttcgctcaGTACTTATGTTGCTGCAACCGCCTCTTTTCCTGGAGAGCTAATCAAAGTTGGATCAACTTGTGCTGCGACCGCC
GGTACCATTCTCTATTGTGGTCGCGCAGAGGGTTCATCGATACGTGGTAGTGGGTTAATGCAACACAAATGCGAAATACTTCGTCGTACAAGTCTTCCTT
CCAGCGGTACTTGTCTGCTGTAATACGCCACAGCATATTTAAGCGCCCGAAGAAATCCAGGTGGGAGATCAGGGGGTCAACTCTCTGGAAGAAATCAATT
ACCTGCGTCAGAAAATCTGGAAGTATCGACATCTGCTTATCGGCAAGGGTATTGCGCTACCGCCTGCTGCCAGAGGCGTTGTATGTGACATCGATGTGGG
AAACGCTAAACCGATCGCCCAACGCGTGAGAAAGGTGGtcccgcagctgcaggaaaaGTTGTCAACGCTGATCAAGGGACTGCTCGCCTCCAGCATAATC
CGCCACTCGACGTCTCCCTGAGCTTACCACACAGTAGTGATCAGGAGGTAGACATACTGACTACCGTGTGCATTCACCGATCTCCCCTGGTGATCCGCAA
ATTTTCTTGATCGG