Description :
From Genome Similarity Track
Location :
Scaffold_349:9365- 11729
Sequence
2364 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGAAGGCGCGTCAAGGGTATGACCGGTTGAACATCTGGGTCGACTTTCTGGAGCGTATGTTGAT
AGGATAAGCGCGCTCGAAGCGCAACCCTCTGCGGTCGTCAAGACCGAGGACAGGTGGAAGTCACTCATCGTCTGGGAGTGTTACCTCGTCGCAGTCCTCT
CCACGGTACCATCGTTCGTCGCATGGTCATCGACGTGATCGCTCACGTTGGACCCATGCGGATATGTGATCTCTTGAGGATCTACATATCGCTTTAGACG
ACCCATGCAAAATACGGAGGTGTCTTCATGTGTGATGGAAGGGTGAGACTATAATTTAGGTCTCCTACCTTCTCTACCACAGAAAATGCTCGATAAATCG
TGGCAAGAGTTTAAAAGTACCACCAAGTAGTGCTGAAACTGCAGGTTTCGGTAATGTGTTAGTACTTAACAGTAATTTGTATATTATACTAAAGTGTCCA
TGATTTCTGCGACCAATTTGGTCTGCATAATTTTTTGCTTATTCTGTGCGCTTGTCATAGCGTCACGGACCTTACGTGGGATGGATAATAGCTTACCCAT
AACGTTTTGAGCTTCTCTAACACTTTTTGCATCCAGATCGCCAATGACACCACCAAGAGGTCGGTCATGGGTCGTTGCTGCTCATGACGACCTATTTCAT
TGCTTTGGAGCATTGAAAACGTGTATAGTGACTCCGACTTGACACTATCTTGTGTCGTGAACACTTCGGTACTGGCACGATCACTAAAGAGAGATTCTAC
CTAATATTGGCGGGACCATTACGCTCTTCCGCATTTGCTCTGAGCGTAGTGAGGCCCCCCGTAAAGACTCGGCCACGCACAAACGAGACTGGCGTCTGAG
AATGGCGCAGTCTATTAACATAAAACGGTGTTTCACCCGTGCTGGCGTGAATACTACTGTTAATAGCAAACTCCGCGAACCACAAATGTTTACTACATTC
CCTGGGAGTTGCTATTGTGCGCAAACATCCGCCACTACACTATTGACCCGTTTGGTCTTGCCATCGGTTTAAAGATGATCGGCGGTAGATATGTGGAGCT
TGCTACCAAGCACCTTGAACACATGGTGCCAAAACCCTGACGCAAAACGTGGATCCCGGTCGCAACCATGGACTAGGGCAACTCGTGTAGTCGACACACA
TGATCCAGGAACAAGAAAGCTGCCTCCTTGCCTAATATCTTTGTGCGAAACGATGCTAAGTGCACCGTTTTGATCAGTTTGTCATCAAAGACGACGAGTT
TAGTCCTGCCTTGATGTCCAGGCGGCATACCTAACATGAAATCCAAACTGACCGACTTCCATCAATCAGTAGGTATTGGCAGCGGCTTTAGTGGCGAACT
TCTTGAAGGTGCCGGATTTACAAGCTGACTCTCTTTGCGCAATCGAATACAATGAGCTCCCACCATAATAGTTGTGGCTACCAAAATTCATCTGTCACTC
GTCAGAATGTCGTCTCACGGCCCAGATGACACCTTGATGGTGCATAATTGAGCTCGTGCATAATCTTCTGTTTGAGATCTGTTTCATTGGGGAGATAGAT
TCGAATTGGATCACAAGATGACGGTTGATGCCGTCACGGACAATCAATATAACTAAAACGGTTAAGCTTCACTTTTAGGTGCGACAAAAGAGTAACCTTT
CGCCCACCAAAGTGATCTATATGCAGACGACAATGTTCGTCCTGCTTGTAGCTCTTCTTTATATCAGAGGCCAGATTGTTTGTCACATGGTCAACCCTTA
GGGCTGCAAGTGTCGACGACTCAATTCGTGCTTTAGCACGAGACACGTCTTCAACGTGTCGTTTCTTAAAGTCTGGTCTGCCCGATAACGCATCAGCCAA
TACATTCTACTTCCCCGTCTTGAATTTAACTCGAAAATTACATTCTGAGAAGAATGTGAGGCAC