Description :
From Genome Similarity Track
Location :
Scaffold_1368:936- 5867
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1368-snap-gene-0.2Oxidation resistance protein 1

Sequence
4931 bases(100 bases per row)
ACAATCTCCAACAGCACGATCCCCAAGCAGAAAATGTCGGCCGACGGGAGACGCTCGCGACTGGCGAGCAGCTCTTTTGCCATGTACACGCCGTCGCCCT
CGAGGTCCGCCGAAAACTGCAGTTTGGTAGATGAAGCAGTCACGGTGGTCGCCATCCCGAAGTCACCGACTTTCAGATGCCCGCTCTCGGTTACGAAGAT
GTTATCAGGCTTGAGGTCCAGGTGCACGATGTCGTGGCGATGGAGCACGTCGAGACCGGACGCGACCTCACACAGGATCTTCCACACATCAGATTCAGAA
ATGCTGCTGGAGGAATCGGCGTGCGAGCCAAGGAACTCCTTCAATGTCCCGCCAGCGCAGAGCTCTGTCTGCAGGTACAAGTAGCCTGCGTAGAAAAATA
ACCGAAAGGATTAGCTATATCATCAACAGTCTGAACATGACCAACAAGAGACGGAGTTGATATCGCACCGTTGTCCTGCCACGCCTGGTAGTAGCGCACG
ATATGCTCAAAGTGGCTGATTGAGGACCCCAACGGCTGCAGAATTTGGATCTCCTGCATCAAAATGGAACTGTGGCACAAAAGTAAACCAGATCAGATGA
ATAGATTGCATAATAGTCCATGCAGCAAAGTGAGTTCAGGCTATTACCGTTCTCGCTCGCTTCGGAGCTCGTTCTTCGACTTCTTGACTGCATACAGAGA
GCCGTCGCGCGACGAGCGAGCTTTGTACACCTCCGCTGAGATCCCGGATCCTAGCCAGCTGAGCATCTCGAGGTCTTCGAAAGGGGACCCTAGCTCGTCC
TTCAAAAAGAGATTTAAACAAAACAAATCACCGTCAGTTTGTATACAAGGTGGGTATCATTGAACTACCGGCATCTTACGAGAACAGAGACGTACCTGTG
CATCGGGAACGGCGAGCTTTGCTAGCACTTCTCGCCGTCCGAGGATCTTCTGGCGAGCTGTTGACAGCACAGGGAAGCGCATCAAAAATCAGCATAGGTA
TCCAATGTGTTAGGATCGTGAATTCAGAGTATGAAAAGTACATGGAGTGACGCTGGAGCTCTTTTGGGGCGTTCTTGGGACCTGTTGCACTGGGCTTTTC
ATCGACAGGTTGGCGGTCATGTCTTTGCTGAGCTTCACTGTTGTCGGGCTGTGCAATGGCGACTTGAGTACCGAAGCGATCGCCTTGGACCTTGGACCTT
GAGTGAACGCTGAGTCTGGTTCGGCTCCCTTAACAAACGGTGAGATGAGCGAGTGGCGACCTGGTGCCGCTCGCAGCTTTCGCGACGCTGCTGGCTGCAA
TGCTGGCGAGCAAAAGTCTGCCGTAGTGGTTGCAGGCATGGATGTCACAGGGCTGCGTCGCCTGCCTTTGGTTGGTGTCTTGCTTGTCATCGGATGATCG
TTTGGCTCGGTCGATATCAAAGGCGATTGCGGTCTCCTGCGTAGAGCTCTTTGAGAGCGACGAGATGGTGGCGTCACGTCCTTCGTAACTGCGCTCGATC
GCTCGGAGCGGAGCGCTTTGCGTCCATGATCGTCGTCGTGTTCGTCCACCTGGTCGTCGTCGTCGCTGCTCATAGCGTCCATGAAAAGCGCTTTGTTCAC
TCGTGGCGAGCCGGGCCTGTCGCATTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGTGCGCTTTCGTAGCTGATACTTTCCGCGCAGTCGCGATCGCTTCTGGTGATGACAATTCGGACGAGCGCCTCGAGCGCTTTTGCCCGCTGC
TGCTACCGCTCGAGTAGCTGTGCACGCTGCCGTAGCTGCTGACATTGCTGCCGTTGCTGAGCGGAGGCACTGGGCTGCTGGTGTCGTCCAGCGCGGCGTC
GAAGAGCCTGCGCGCACGCTCCGGGGACCGCATCGTCGCCATCTCTCAATGTTTTTTTGGCGGGTAAATAAATTATTTTGGGTTTTCGCGCGTTTTTTTT
CAGTAACTTCTTATCTCGGATACCATAAACCATAAACTCTTTACAAGCCTATTACTCCTCTCAACCAAGCCATTTCTATAGAGACTTTAAAGAGGCTTAA
GATTCAATCATGAACTGAAACAACAATAATTTACTCTTAATTGACCTCGTTTCATAGAGGTTTACCTGAAATCCAAGGACGTTCTCTGCGTCTCTTTGAT
GCCCGGGATTGCATCTTGGTAACGTACCAGAATTAGACGAGAGGGAAGGCGACGCGCCCTCGCTTCTGCACGCCCCAGTACACGCGTCCAGTCTCTGCGC
TCTTCCTGTACGTCTGCTGGAGCGAACGCGCCAGCTAGTGGCAGTGTCCGCAGTGCGCCTCTCGTTACGCGAAGCAGCACATAGACACCAGCAAACGCCT
GGAACTTCAACCGACTGACTGGACAAGAAGAGCGAGCGAGAAGGAAGGAAGAGAGGATGCTGGGCAAGCTCACGCATTGGCTCTCGATGAAGCTCGAGCT
CGAGGACAAGGAGGACGACTCGCTGCGGCTGCGCTTCGACGCGCTAGTGCGTTTTATTGGTGTTGTTATTGTGCTTGGCTCGATTGGACTGTTTTTTTAT
AGGTGGTGATGTGTTTGTGTTTGTTTGTATACAGACGCATATGAAGAAGGTGACGCTGGACGTGGTGCAGACTGCGAATGAACGGCTTCTTACTGACAGC
GGATCACGAGGAGGAGAACAGGAAGCGAGTGCTGGCGCTGTGGGGGATAGCAGCGTTGATGTGCCGGTGGACTCGGAGGCCGCGGCCGTGACGACACCGC
CAGCAAACGCGCGCGAAGCGAAAGACAACAGTGGCGAGCGCGTCATTTTGACGCAGGAAGACCAGTGCGTCCACGATTATTGTGAGTTCGCATCCCCGCC
TCTAGTCGAATCGCTAGATCGCTCATAAGTGTGGTGGATGTATATGTATATGTATGTGCGTGTATCTTTCTAGGTGCGGCATTGGGAGACTGCTTGAAAT
TGGGGCTAAAACCTCAAAGCGGCCAGGACATTTCGCTGTGGAACGTACTCTACTCGTGCTCGCTCGTGGTTGATGAGCCGGATTTCGTGCAATCGATCCA
GAACGCGGCGCTGCTCTCAAACGTAAGTGGTCATCCTCTTACTCATTCAATGAGCTTTGTCAGTGTGATTTTAATGGGAACGTGTGTGTTGTACAGACTG
ACGAGGGCAAAGAGCGCTGCTGGCTCAAGATTGCGCTGAACAACCACTCTCTCGAGTCGACTCTCCTGGTACGTTTGCTATGAGCTCACGAGAAAGAATC
TTGCTAATCGACTCATTATTTGCATATATATATACATATATCGTTATAGCTCATCTTCTCGGTGCAGTGTGACCAAGTGATCCGGTCAAGCTACGAAGAG
TGGGCTTTAATGCGGTGCTGCGAAGGCATGGGGCTCTTCCTGCAGATGGTGATGGATGTGCGCAACGTGCACTTTGCGATTCGCGTGAACGACGATCCGT
TCAACACTACCGAGCCGAAAGAAGTCGTCACTGTACCCATCGCCGGCGCTGCAGGAGATGATGCAGTGACCACCGAGGCAGCAGCAGACGCTTCGAGTGG
CTCAGTGATAGCTGAAGCAATCGCAGTATCCGCTGACAAGCTCTCGAGCGCTGTCGTCGCTGATTCGAGCATCGCGGATGAAGAGTTTGTCGAAGTCTCG
TCGATTTTCTTCCCACACCGCCACAAAGGCATCAAGCCGTGGCAGCACGTGTTTGGCGTTGGCATTTCGTACCTAGCGAAGAATCCGTACCACTCGCGCT
TCGCTCTGATCGACCCTGTGCTCGCGATTCCCAACTTGGTGCAAGACTGCATCGACTTCCTCATGGAGCACCCTGATGCGCCTCGGCTCTTCCGCACGAC
AGTATTAAACGTCCACATCAACCAGCTTCGTGAAATTGTCGAGACGGATGGAGCGCTACCGCCTGACCTCGACGCGCCTGGCGCTGGCGCTCTGCTCATG
GATTTCTTTAAGAACCTGCCTGAGCCGCTGCTGACCTCAGAGAAGTACGAGGCGTTTATCGCCTCTGGACGCCTGAAGGATGAAGACGCGAGCATCCGAA
ACATCACGTGTCTAGTGCAAGATCTGCCCGTTTGCTGCAAATTTGTGCTCGAGAAACTGATTTTTGTGATGCACTTCCTGGTCGAACACGCAGAGCAGAA
CGGACTCGACATCGCGACTGCGTCCGCGACTCTGGCTCCAGTGATCGCGTTCAAGAAAGAGCCATCGACGGGACCATCGGGACAGCGGCGGAGCACACAC
TCACAGTACCAGGACGTGCGATACGCTGCAGTCGGCGCCCAGGTCGTCGAGCGCATGATCAAGCACTACGACGTGATTTTCCAGGATGTCCGCGTCCAGG
TGTCCGATGCGCTGACACGGCTAGAGGCGAAGAAAGACGCGCTCTTGTCGATTTATCAGCTGTTCAAAATGAAGCCCCAGGTCAACTTCATGTCGGACAA
GCAGTACCTGGAGGAGATCACGAAGGCGTTCACGGACAACGTGAGACAAATTGACCTGCTGCGCTCGCAACAGTCCGTGAACAATTCGGACCGCATCTTC
ACATCGTCAATCGTGCACCCGAAAGCCACATCGCCGATTCGCCACCGAGTCTCGATGCCGCAGATCATAGCGTCGGATGCAGAACTGCCCGGTTCTGAGT
CTATAGCGCCAACGTCATCATCAGTACCCGGGTTAGTTGATTCCAGGACGGCTAGTGGCACAACCACCCACTCGACTGCAAACTTCAGAACGGCCAGTGG
CACGAGCACTCACATTGGCGTTGGCGCGCGA