Description :
From Genome Similarity Track
Location :
Scaffold_3379:936- 2562
Sequence
1626 bases(100 bases per row)
CGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCAGAACGTCAACCTACGGTAA
TAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAA
TGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGCTCCTG
ACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTG
TGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAA
GAAAGAGCCCAAGCGCCGAATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGCGTTTCGATGGATCCGCTCGCATACTACGC
GGAGGCGGGGCGTACAGTGCGATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGG
AGTATAACGGGCTACTGCTGGTTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCG
AGGTGAGATTGACTGCAAGGCGCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAG
CGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGTAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTA
CGTTGAAGCGACTAGACGAAGTGGTGGTAGTTGGATCCAGGAAAAGAACAGTCCAGGTGATGGTCGTCACTAGGCCCAGAGGAAGGATTGGATCCAACCC
TTAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGAATCCTAGGACTAAAGAAGTATCTG
ATGGGGGATGTACGGGATCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCC
CCCCTACGAAGAGAGTCAACGAGGAACGGGATAGATTGATGAGGCTGGTGATACCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCTT
GGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGAA
TGTGTGGATTGTGAGACAAGCAAGGGCAGGCCCACAATCGAAGGGGGGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATC
ATATCCCCTCGTTGCCCAAGTCGTTC