Description :
From Genome Similarity Track
Location :
Scaffold_98:93575- 95258
Transcript NameFunction/comments
Sapdi_VS20SDRG_15662hypothetical protein

Sequence
1683 bases(100 bases per row)
CTTCGTCGAGCATGTGGAAGACGCCGACGGGCTTTGTGTCGAGGAGCTCGAGGCACGGCCGGTTGCTCGGGAAGTTGACAAAGCTCCACGCAATCTTCTC
GCGCTCGTACTGCTGCTGCTCTTGCGCGAGCACGGTTGCGTTGAAGTGTTCTTGGAGCGTCTCGTTGGCGTAGTTGATGCAGAGCTGCTCAAACGAGTTG
GTCATTAGGTCTTCGAAGCCAAAGATGTCGAGGACGCCGATAAAGCCTGCGAGGTCGCCGTCTTCATCGTGGTCGATCGTCGCATTGATCTGCTTGACGA
GCCAGTTGAAGAGCTTCCCGTACACATACCGCGAGAGCGCATCGCGGTTCTGGTCGGCCACCTCGGGCTGGAGGCCGATCGAGTACGTCTCGTCGCGGGT
CGTAATCTTGCGCGTGCACAGGGCAACTTCGAGCGACTCGCGGTCGACTCGGAGGTACGCCATGACTTGGTGCACCGCCGCGTCGACGCGGTCGTCGTCC
TCGAAGAGCATCGAGCCTTCGTCATGGCCCGATCGCTTGGACTGGAACGCGAGGTTGCCCATGTGCAGGACCGCCGCGACCGTAAACACAATGCTATCGA
CGTCGTCCTCTTCAAACTGCATGGTCTCCATGGCTTCTTTGAGCAGCGCAAACTGCTTGACGTCGTCGACGCCGTCCTTGCGCTTGATGCACTCGCTCTG
GTTGAGGTAGTAAAAGTCCTTGGGCTTCCCGAGCGCGTACTTGGCTCTCTCATCACTTGATGCGCCGGCGAGGAGCTCGTAAAAGACGTGGTAGTTGCGC
TCGTTGGGCGCCTGGGACGTGACGCGGATGCTCTCGAGGAGGTACACTTGGATCGAGGCGCCGATGAGCACGCCGTAGTGGTCAAACTGCATCTGGATAA
ACTTGCCAAAGCGCGAAGAGTTGTCGTTGCGGATCGTCCGCGCGTTGCCAAAGGCTTCGAGGATCGGGTTGGACGAGAGCACTTGGCTCATCACGTCGTT
CTGGCCGACGTTGATGTTGCGCATGCTCTTGTTCTGCGAGACGGCCGCGAGGTACTTCATGATGAACTTGGTCGTCTCGGTCTTGCCCGCGCCCGACTCG
CCACTGACCAAAATGCTTTGGTTGGACGCGGTGCCCGTGAGCGGCGCCGTGAGACTCCGGTACGCCGAGTCGGCAATGCCAAACACGTGCGGTGGCATCG
TCGACTCTTCGTCGCCGAGCGCGAGAAGCGCGCCGTGCCGAATGTACTTGCGGATGAGCTTGTCCGAGTAGATGCCAATGTCCTGGAACGGGTTGACGGC
CAAGAGGATCTCGCCTACAAGAGGAAGACGCATGAGTGGAAGCTGTTCCGCTCTCGATTAGGGACCTGTGAGGGTATAAATATCGTTGATCGTGAAGCGC
TCCTTCAACGTATGGCAAATGCCAGGTTCGTGCAAGTGCGGCAGTCGGATCAAGTCGTCGACGAGGTCCTACACGCGACTCCATGAGGCGAGGCGGAAGC
GGAGGCGGCTACCATGTCGTAGTTGTTGGCGAGCTTGATCGTCTCGTCGGTCGCGTCTTCAATGGCGGCAATGTCGACCTCCATGGCGAGGTGGCCGCGG
CCCGGGACCTCGACGTCGATGGCCGTGAGGCTAGAGCTCGACGCCTTGGCGATCGATCGGACGGTCGCGAGCGTCCACTCGTC