Description :
From Genome Similarity Track
Location :
Scaffold_128:9357- 10867
Transcript NameFunction/comments
Sapdi_VS20SDRG_16427hypothetical protein

Sequence
1510 bases(100 bases per row)
GGCGGTGGCGTCTCGATCAATGGTGGGCGTGGTAACATGCACGGCGGCGACGTGTCTGTCATGTCTGGGGAGGGTGAGCGGCAATCGGGACGCGTCGTTC
TCGCGTCGGCGGCGGCGCGTGGTCCATCCGGGCCTCTCACGCTGACGTCCGGTGACAGCGCAGACGCGTCGGGTGACATCACATTGGCGCCCGGCCGCGT
GGTCGACGGCAAAGCGGGTGACACGTCCATTCATGGCGGCCACGGACGCTTGGGCGGGTCGATCAACCTCAGCAGCGGACGCGGTACGGAGCAGCATGGC
GACATTGCGATGACCGGCAAGACGGTGCGCACGCGGGCCGACGATGCAGTGGACGTGACGACGGGAACGTCGTCGCTTTCCATGTCCTCCAAGGATGGTC
TCTCGATCAAGAGCTCGATTGTCGAGGTCAAGAGTGTCAACTTTACGGCGCATGTCGACGGCCAGTTTGCGGTGGCGCATACCAACAAGGACGGGTCGCG
CAACATTACGCTGCGCGCACTCCCCGACATGGTCATGAGCCACGTGCCCATCCAAGCCGCGAAGCTATTGACGCCGTCCGACAGTCGCATCAAGACCAAC
ATTGAGAGCTTTGACGAAGAGGACATTTATCAACGGCTGCAGAAGCTCGAGCTCAAGTCGTTCAAGTACACAAACGCATGGAGCAAGATGATGGGGCTTT
CCAACGAGACGATTCGCGGTGTCGTTGCGCAGCAAGTCGCCGAGATTTTCCCAGAGTATGTGGATGTCCGCGAGGACTTTCACGTGTCGGACCACGGTGT
GCGTGTGGCAAACCTTACGCAGGTCAATACGCAAGCGATCGTTCTCGACTTGTTGGCCGCGCTCCAGGCGCAGCAACGTCGACTCGCGCTCGGTGCCAAC
ACGCCGGATCTCAGCGGTAACTTGGACCTCTCCACTGCCAGCACTGGCGAGTATTACAACAGTGCGGGTAAAGGCGCAACGGGTAACGTCACCGTCACGA
CGGGCACGTCGAACGGTGGCAACTCTGGCACCATCCGCATTGCGACGGGTGGTGCTCGCTCCGGTGTGGTCGGCTCTGTGCAAATTGCTGGCGGCAGCAG
TGACGTGTCGGCTGGTGGTCGGATTGAGATCACTGGCGGCAATGTGAACCGGGTCGGCAGTGTCGGTGGCGACGTCTTGCTTCGGTCCGGGTCCGGCACG
TCAGCGTCAAGTGGCGCGGTCAACATCACTACTGGAGACGCAGGGACCAGCGGCGACGCTGGCGCCCTCTCCCTTGGCTCGGGAAGCGCGCCTTTGGGCC
AAAGCGGCCTCGTGACGCTGTCCAGTGGTGATGCTCAGGCGGATGTTGCAGCCAACGTGCGCGTCCTCGCAGGCAGCGGGCGTCGCCAAGGTGGTGCAGT
CGAAGTCACCGCTGGGTCATCGAACGACCGAGTCGGTGGCGCTGTTCGTCTAACGTCGGGTACCGGCAACCAGCAAGTGTCGGGCGACGTCACGCTCAGC
AGTGCGTCGT