Description :
From Genome Similarity Track
Location :
scaffold_47:93530- 97304
Transcript NameFunction/comments
g2044.t1 hypothetical protein PHYSODRAFT_524057
g2045.t1 phosphoglycerate kinase

Sequence
3774 bases(100 bases per row)
AGTTGTGCCAACGACAGCTTCCCCTTTGACGTTTACTTTTACCATGCCAGCATCGGCTTCTACTCGTTTTACGAACAGGAAGCGGGGACGTATTGCGCTC
AAGATCACACTGCGTATATCGCTGTGGAGATTCTCGGAACGTACGATATCAACGGATCCGTCTTGGCAAAAGACACTGGGAGCACAGACCCCAGAGTATC
CTACTGGTACAGCACTGTTGGTGCGATCTGGATAATGTATCGCGCTCTTATGATCCGTCGGAGCTTTGTTTCTTGCCGACGCTACGGCACGAGGTGTGAC
GAAATGCGTGAAAACCTGCAGCTAGCAGAGGCGACCGTATTCGTACAAGAGAGTATGCGCCTATCCGCGCAAGGGGCAACCAACTACCAGCGAGCCGCTC
TGCTCTATCTGATCGTGGAAGGCATCATGACCGACTTGTTCCTCATCATTGCAAACGATGGCTGGCTCACCAAAGTCCAGTACGCGTCGTTAGGCTACAA
CTTGTCTGGGCTGATGCTGCTGATGTTCGAGATGGTTGAGAGAATGCAGTGGCTGAATGAACAATGGCGAATGCGGATCAAGCGACTGTTCTTCAGCTAC
GAGACAGCTCTAGTGGGGGAATTCGTGAGTGCTCTTGCGTTTCAGCATTTCCTCACGGGGTTAAACAAGTCCGACTTGAAGCGGTCAAAGCCAACAGCTC
TTGCGGTATCTTTCTACCTGTGGAGTTTAATTTGTCACGGCATCGTCGTGGTGATTGTACTTGGGATCATCTCTTTTGTGCGGGGTCTGTGGGCATTGTC
ATTTGTGTGGCTGAAGCATCGGAGTTTTACAATATTTTCAGAGCCTTGCTGCGTGGACACGGCTCTGGGTACCCGCAGCAGAATCATTCTGCTTGGGGGC
TATGTCTGGGGAGGTAATGGTCTGAACTACACGCCAGGAGCTCTGAAGGCGTTCGGGGTACTGAAGATGGAGGAGAACGGAGTGGAATATTTGGTCATGC
ACAAACTGAACTGGTTCTCCGTTCCGATAAACAATTTGATCGGAGTTGGGGTCATCTCGGACCAACGGGTCGAACCCTGCAAGGAGCGACCTTGCACAGG
CATTGTCAGCTTTCTTGATAGAGGCTTGGAAGGCGCATCGAACCTGTCGGCACTCCACCATCGTCGTCCAGTCACAGTTAAAATCTTGGTTGGGCCAGAG
AATAATTTGTCGTAAAATGCACTCACCAGTTTTGTGCTTAGTTGTAACAGCAAGTATGTCACGATGAGAGCTTGCAACCTGTGCGTTCAGTTACATTGGT
GGCGGCAAAATACATGCATTGGCGTGTAGCATTGTCATGGATGGGACACGACGGCCATGTTCCTCACCGCTACGAACGGATATTTGCCATGAATCATGGA
AACGAACGCTCAAGGTGGCGGCCATTTCTGTTTGTATTCGATCGCTCTTTCGGTAGCTAAGTGAGTCAGGCGCGACCTTGCAACAGGTATCCTGCTACGT
CTGGAGCACGGTGCAGTTTGCTGTTCAAACCAACCCGTGCAACAACCTGTTCGCTTGCCTCAACACGCCCCGTTAGTTATTGGCACTTTTCAGGGTATCA
ACTCAACTATCGGGTCGCTTTTAAGCAACACAGCAAGTCAATAAGTGAGCTACAACTTTGTGTATGTGCAATTGTGCATGTACAGTAGTAATCGAGCAAT
ACTCGGAGTATGCTCGACAGCAACCACGATCTACAAAACCGTTTTGTCAAAACGTCTTCGCATCAACTTGCTGAAGCTTTTGAGTAGACACCACATTCCC
TGCATCTCTGACTAACCCTCGCGCAAGAAACTCGATTCAACACGTTCAGTGTCAGCACAACTACCGGTAGCAACAATAGCGCTGCCGATTCCTTCAGCGC
TGCTAGACGTGCGCCACACCTGCTGTTTGGTGGACCTCCTGCAGGAGTCCTGCTACCAAAGATCGCAAACATAATTCACCAGTCGTTCGTCACTTACTTG
CTTACCTTCGTCTGGGATGTACATGTACTGTTACTGGCAGTGAAGAGCATCGGAAGCCTCCGGCAGGCAACTTTGACGCAAATGAACGCCCAAGTGCTTG
CCGTCGGCGCGTACGTCACTCCTCAGCTCTATTTAGTGTATGGCACTTAAACGTGCGACACGTATCGTGCTTTTTTATGTTCTGAACGCTTAACTTGATT
AAAGTATTGCTGCGTATTTATGCATTTGACGCGCCAGCGTGGCTCGAAAGCAATCGAGCCCAAGCACCCTCTTTTGGCAAGATTCCTCACCAATTGCCAG
TGCAAAAAGGGGCGCAAAAAGGGGCAGCGATCCACGTCAGAAGTCTCCAAAGATCTCATTCTCGAATTCACCTCGAAGTCGACAAGTGACCATCACTCCT
CCTCCAGCCACAATGGCCAAGCTCAGCATCAAGAACGTGGACGTCAAGGGCAAGCGCGTGCTCATCCGCGTGGACTTCAACGTGCCCTTCGCCCAGGACG
GATCCATCTCCAACACGCAGCGCATCGACGCCGCGCTGCCCACCGTGCAGTACGTGCTGGACCAGGGCGCGAAGGCCGTCGTGCTCATGTCGCACCTGGG
CCGCCCTGAGGGCAAGCCGAAGGCCAAGGACTCGCTGGCCCCCGTGGCCGTCGCCGTGGAGCAGAAGCTCGGCCGCAAGGTCACCTTCCTCAAGGACTGC
GTTGGCCCCGAGGTTGAGGCTGCGTGCGCCAACCCCGCCGAGGGCAGCGTCATTCTGCTTGAGAACCTGCGTTTCCACGTTGAGGAGGAGGGCAAGGGCA
AGGACGCTGAGGGCAACAAGGTCAAGGCCTCGCCTGAGGCTGTGGCTGCCTTCCGTGCCTCGCTCAGCAAGCTCGGCGACGTGTACGTGAACGACGCCTT
CGGCACGGCCCACCGCGCGCACAGCTCCATGGTGGGCGTGGACCTCCCGGTGAAGGCCGCGGGCTTCCTGCTGGACAAGGAGCTCGTGTACTTTGCCAAG
GCCCTGGATGCCCCTCAGCGCCCGTTTGTGTCGATCCTGGGTGGTGCCAAGGTCGCTGACAAGATCCAGCTCATCATGAACATGCTCGACAAGGTCGACG
AGATGGTCATCGGTGGCGGCATGGCCTACACCTTCAAGAAGGTGATCAACAACATGGAGATTGCCAACTCGCTGTACGACGCTGAGGGCGCCAAGATCGT
GCCCCAGATCGTGGAGAAGGCCAAGGCCAAGGGTGTGACTCTGCACCTGCCCGAGGACTTCGTCATTGCCGACAAGTTCGCCGCGGACGCCGCTAAGAAG
GAGGCCACCCAGGACGAGGGTATCCCTGCTGGCTGGATGGGCCTGGACGTTGGCCCCAAGTCTCAGGAGGCGTTCAGCGCCGCCGTGACCAAGGCCAAGA
CCGTCGTGTGGAACGGCCCCATGGGCGTGTTCGAGTTCGACGCCTTTGCCAACGGCACCAAGGCCGTCATGGACGCTGTGGTCAAGGCTACCGAGTCGGG
CGCCACCACGATCATTGGCGGTGGCGACACGGCCACGTGCTGCGTCAAGTTTAACACGGAGGACAAGGTCTCCCACGTGAGCACGGGCGGCGGTGCCAGC
CTGGAGCTCCTGGAGGGCAAGGTCCTGCCGGGTGTGGACGCCCTGTCGTCGGCGTGAATGGCACGGTCTTCCGATGCTTCCGTCAGGAGGAGCGGGCTGT
AGGCATTGTTTCTCGTTCCATCTCTAATCACAACAAATACACTTAGCATTCCAACACAAGGAGATCTTGAGCTT