Description :
From Genome Similarity Track
Location :
contig_7:935270- 936678
Transcript NameFunction/comments
g2174.t1CAMK protein kinase

Sequence
1408 bases(100 bases per row)
GCTGGTCCACTCGGAATTTTGCTCGACGGAAGCTGCACCGATGCAGCTTTGCTTGACGATTTTGCTCCCGTAGCTCGAGAAGGCACGCCTGGCGCCGTGG
AAGGAGTGGTAAGGTCCCTCATGGTAGCGTTCTAGTCGGAATGGACAAGTTCGACTTCGTGGAGCAACCGCGGAAAACTCTTGCTGAAGTCGGCGCCATT
CTGCGAGAAGCTGCTCACCTCAAGCGTCAGCTACGATTTCGAGTGCCACCGCAGAACTACCAGAAGCCAGATCCAGCAGCTCATGAGAACGACAAGTCAA
AGCTGTTAACGGGTGCACCAAGTAGCTCAGCGAGCGTTGTGGGGGGCAATGAGACTGGCAAACCTACTGGTGAATGGTCTAGCTGGATGAGGGGTGGTCT
ACGAGCTGCAACCACAATTGCTGCTCCAGCGTCTCGTGTAGCACCCCCAAAGCAACAGGTACCACCAGCTTCGCAGCCAACACAAGAGCCGACAGCGCCG
TCACTAGCTGTGCCTCCAGCATTGAAGCCAACAGGTAAACCAGCTTCGTTTGTGCGCGTGACAGGCTTAGAGGACCGCACACTGAAAGCAGACAAACATC
CATTTGTGCCAACCGCGCACGATAAGGTGGTGAGCATAGAGGTACCACGAGGTTCACTCGGTCTGCACCTTGACGGCAGCGTTGTAAATCGTGCTGTGGT
GCTGGGCTTCATGTCGCTCGCCGATGGCTCTCGCGGCGCACTCGAACGAAGTGGCAGCTTGGCTTCTGGTGCTGAAATTGTGGAGATTAACGGAGAAGAC
GTCTCGCAGGAATCTCTAGCTGGAATTCGTGAGCGGTTGGGTCGTAGCAGTGGTGAACCGCGTCGCCTTAGCTTCCGACTGCCACCTCCGATCAAGCTGG
TGGTTCCATTGGTGCCAGACGGTTCCTCGTCGGTAGCAAGTTCGTCAGTAGGCTCGCCACCACCAGCAAGTCGGCGGGTATCCACTGCCAGCATGCAGCG
CATGAACCTTCTCGCGGCTTCCCAGCCCACGTACTCGGAGGACACGGAACTGCGCCGACGTCTCGAGCTGAAGTTGGTCATGAGCTTCGATCGCAAAGAG
ATCAAGTACAAAGAGTGCTGGTTTGCAGTTCATACCGAGTGGATGAATCGCTGGGCGCTTTTTGTGGGTAAAGGAGGTCCTGAGCCAGGTCTCATAACGA
ACCACGAGCTATTGGAGCCTGGGTATGCGTCTGGTGAAGACCCGAACCGGGCTGCTTTTGTTCGGCCAGGGCTTGCGATCACTAAGGACTTCCGCCTTGT
GACTCCAATGGTCTGGAGTTTGCTCGTGGCTCTGCATGGAGCAGACAATGCTCCTCCGATTGCAAGGTTTGGACTAAACATCTACTCAGAAGCACCTGAA
GATATTAA