Description :
From Genome Similarity Track
Location :
Scaffold_4:935267- 939483
Transcript NameFunction/comments
Physo_546253putative zinc finger protein 2

Sequence
4216 bases(100 bases per row)
TGTGGCTACCGTGCTCGGGTTGAATTCCGAAATGCTCACGTATAATTACCCTTTACTAAACTCACAGTACAGTATACTCTAGTACGTGCCATTTCAATTT
AAAACAGTATAATTGGCCTCATATCAGCTCCGTACCTCGCATGACGCCACATTATAACAACTCCTAATAGCTGCCTATACGCATGCGCAACCGGAGTCTA
TTCTCCATGTATTAATACAACTCACTTTATGATGTCTCGCGAGTAATTTAATTCAAATTAACTCGCGCGGGTTATTCTGAAGCATCTGGACCATTTTAAC
GCGCGCGAGTTATTTTGAATTTGAACCAGGCAAAGCTATACTGAGCTCAAGTAGATGTACATGTAGTTTGTGTAGCGGCCATTCGCAGGCGCCCGGCTTA
GCGCAGGAACCTGGAGAAAGGGCAGTAGAAAGGACAGGTTGCTAGTGATCGAAAAAGTGGTTGTTGACGATCACTTTCCAGCTCTTTTGGTTGTTCTCGT
CTTTTTTAGGTTGCCATTGTCCCAAAGAAGGCTGTTTATGGTCCAAAGTTGGTACACTGGCGACCCGGACTCTGCCGCGCGCTTCAAGCAGCCGTGATAC
TCGCCGCTTTGCGCAAGCGCCGACGCTGCTTGTGCCGAGTGGGGCCCGGAGCGCTGGCTCCGGCGGCTGGCGCGGTTGATGGCAGCTCGCTGCACTGCAG
CCTGCACAAGCTCCGCGGCGAGTCGTTGAGAGGCGAGCAGATCATCGAGATCGAAGCGGGCTCAAGTTGCGTCAATCTCTCTCGTCGCGGCAGTGCAATT
CGCATGGGGACACTCTGCAGGACGCTCGCGATGATGATGGCTTCCCGGCTGGCGGCGCGCTCCACCGAGCAAAGCCCGACTGGTTTAACGCCGCCCGGTC
TCAACACACCAGGCAGGACGGCGACTGCGGGGGCTGCTGCTGCCACCGCGTCGAGACGCAGCGAGCGCTGTTCTGCCCGCCGGCACGCCGTCGGCAGGCC
AGCCAGCGCGCTGAAGCTCCAGTCGCCTCCAGCGGCTCCGCTCGGATTTGGCATGACTCCATGGCCGGCGGAGATGCGCCTCCCACGGTCGCAGAAGACG
GTTCGCGCGAGTCTTTGGCGTCGCTCTCCATGCGTGCGCGCGGGCCTCACCTGCTCGGCGGCGATGGCGCTAGGGCACTGCCGCCACTGCCGGACCGGCA
CGGCAGTGCCGGTGGCGAGCCGACGACTGCGCGCAGGTGCGAGGGCCGCTCTGGCCGCGGGGCTTCAAAGGGCTCTGCTTCAAGCCGCCGGGCCATCAGG
CGTGTCTAAAGTATTTCGGCGGCCATCCGGTTCCCTCTCGGCAGCCACGGCCGGGCCAGCCCGCGAATGGGTCCCCTTGGCGAGTCACGCGCGGCGAGTG
GTTTACCCATCTCGGAATGGGCGAGTTCGGCGACGGCGCCAGCTGGCTGCCGCTCACCACATCAGGCCGCGCGCGGGCTGCTCGTAGCGGATCATTTTAC
GTTTGGCCGCCGCCCAGGCAGCACGCCGCAGTGAGTCAACAGCCCCACCGCCACCACCGCCCTCCTTCACCATGATGTCGCTCCTCGCCCAGCCGCTCTC
GCCCCGCTCCAGCAGCCGCCTGGTCTTCGGCGCCTACGAGGCCGCGCCCATGCCGGTGCCGATGGCCGCAGCCTCGCCCAGCGGCAGCAGCACCAGCAGC
AGCAACAACAGCAGCATCAACAACAACACCAAGGACCGGCCCTTCGTCTGCGAGGAGCCCGGCTGCGGCCGGCGCTTCAACCGCAAGTTCACGCTCAGCG
AGCACAAGAAGACCCACACGGGCGAGAAGCCCTACGTGTGCCCGCTGGCCGAGTGCAGCCGGCGCTTCAGCACGTCCGGCAACCTGGCGCGCCACAAGCG
CCTGCACGCGTCGCTCAAGCCCTTCGAGTGCGACATCAACGGCTGCAAGCGCTCCTTCCCCAGCCAGGAGAAGCTCGACCACCACATCAAGATCCACACG
GGCCGGAGGACCCACATGTGCCGAGCCACCGGCTGCACCAAGACCTTCAGCACGGCCGGCAACCTCACGCGGCACATCAAGAACCGCCACCCGGAGCTCG
TGCGGACTACCACAACCTACCCGTCCTACCAGTTCCCGCGCCCCGTCATGCCGTCCCCCATGCACCGGCCAGAGGCTCCGAATGGCATCCATTCGCAACC
CCTGCACATTGCCGACGTCCGGCATGACATGCCGTCGCCTCACATGCTGGCCAAGATCGAGCCGACCCCGGTCTTCTCGCCCGACTCGGTCGAGCTGTCG
TTGTTCCAGGACGAGCTCTCAGCCTTCCAAATGGCTTGCGAGCCACCCGTGCAGCCGTTCGCGGCCCGGCCGCAGGAGCTAGCCGTGCTCGAGGGCCACC
ACCACCACCAGCACCCGCAGTCGCTGAGCGAGATCGCGCGCTGCAGCATGAGCGTGCTGGACGAGGTCATCGAGTTCGAGCTCACCAAGAACGTATGAGC
GGTAGTAGGTTGTGAGTATTTCCAATCGTATATTGATATAGTACATGTAGACTTTGGATCCCCGTCATTTCCCGAAGGACGTTCGTCAATCTTCGTTGTA
GGATACGCTGCAGATCCGATGCGGCGCCATTATTGGCATTTCGTGTAGTGCACGCATTGCAGCGCGGGGCTGGCAAGCAGCAAGCAAGCAGGTAGGTAGG
TATGTAGGCAGGCGAGCAGAAGCACCGTTGCCTGCCGTGTTCGCGTTCGTGTAGCGCCAGCGGAGCCGAGTCGAGCGCGCGATAGGCCGACACGTCAATC
GGTCGCTGCCTCCGACAGGCCGGCCGGCTTCACTTCAACCACGTGGGCTGGGCCTCGCTCTGGCACCTGCGGTGGACACCGCCGGCAAGGAACAAGCATG
GCGCACGGGCCGAACTGCAACGCGCGAGCTTGAACTGCAAGGGCGTGGGAACGATCAAATCGAGGACAAGCTCTTTCTGCGCAGGTGGTGTCCTGCTCTT
TTCCTCGACTTCAAGTTGCCTCTCTGAGCTTTCGCACCGGCACCCGTATTGGAGGTGCCCCACCAAGCTCTTGCACCAGAATCCAGACACGTAATACGGG
CAAGCGCTTCCTGCAGCTGTTGACTCGCGAGGCCCACGTCCGTGTGAGCTAGCCTCGTCTCTTTAAGATCGCGTTACGGTGCAGGAGCCGCTGCAGCAGC
AGCAGCAGCAGGAGGAGGAGGCTGCTAGGATATCTGCACGAACACCGACCGACCGACCGCGCTCTGACCCACAGCTTCGCAGCTCCTGGGCAATTTTTGC
TTGCCTGCCAAACTTTGGCCCTAGGCGCGCGCGTACCATCAAGCACCTGACCAACCTGACGTCACGCGCGGAGGCGTGCGTTGGCGGAGACAAGTTCAAC
TTCACGGTGTCGCGCTGCGATCGAGCCTCGCTGTTAAACGAGCGCCGCGGCAAGAGAGAGAGAGAGCTGATCCTGGTTGCTTTGGGCGGGCGGCTTGCCG
GTTTCCGGTGCGAAGGCTGCTGATGAACGGGTGTTTGCAAATCCTACTCGCCAGAGCTTCAACTGCCCAGGACCAGGCCGTCCGAAGCGCTACATACATG
TACATACAGTATTACGGCAGGTGCAACAGCAACAACAGCAGAATTTTGTCTACATGTAGCTGCCAGCGCACGCACCGGCAGCGTGGCGTACGTATCCCTG
CCTTCGAGTCGGTCTGTTGCCGGCGACATATGATGATGTCTGTACTGCCCTGTGTGCCTGCTCGCAGCATTGGAATCTCAGCTTCAAGCTCAGCTTCTTC
GAGCTCGCTGGTTGTGCCCAATTTCGCCTGCGCTGTTCGCCGCTCGGCGAGACGCCCGGGCTGGTGCTTACATGTAGAAGAGCTGCGAGCGTCGCCGCAT
TGCAGGCGATCGCATCGTCTCCGAAAAGTCACCACCCGGACTGACAAGTGCTCGGGCGTGGTCCTGCCAGTATGTACAGGTTGCAGTACTACCTCAAGTT
CGCCTGGTCACATGAGAGACAAGTCGGGCGCATCGCGTCCCGGATGTGCTGCACCCGATCGATGCCAGGCAGACTTGCCTGGACCTCTGCAAAATTTGCT
TGAGCGAGCAGCGCGGAGCGCTCAGTCGAGTTTGGACAAGGCGGAGAGCGGAGTCGACCCAGGCCGGCAGACGTACATGTAGACGCAGGGGAGGAACCTC
TGCGCCCCGACAAGAG