Description :
From Genome Similarity Track
Location :
Scaffold_824:9350- 12465
Transcript NameFunction/comments
Phypl_g11161hypothetical protein PHYSODRAFT_462099
Phypl_g11162deoxyhypusine hydroxylase, putative

Sequence
3115 bases(100 bases per row)
TCTGCTCCTGACGCCGTTACGCGCCCTTGATTGGAGAGGCGCACCAGGCCACTTGACGCTTGACCGACGACTGACTGACTACCTTTTGTCCGCCGCGGCA
TCTCCATAGCACCGCCGCAGCGGCTTCGGTGCGGTCCCAGTGTACCCGGCAGCACTTCAACACTTCATCGCACTGCAAATTTTGCCGTGTCTCAGTTCAT
CGCCGTCCGGGCTCGGACTGCCGCCGTCCAGCCAACAACCGAAGCAAATCCTGCGTGGAGTCAGCACCAGATCACCACCAATGTCAGCGTGGCGACAAGA
ACGGCACCAACCTTCCGTCGATCGTTTCGTCCGTCGAAGCGGCATTTTGCGTGCGCCACACCAAATGTACCCATCACGCCAATTCCGCCATCATCaatgg
aggccgaggcccAGGCACTGCTCGCAGAGCTCAGCGCGGCGCGGGAggagcacgcgcgcgcgctcgcggcggcgaaCCAGGTGAGAGGCTCGCTCGACAT
TGCGCGGAAGGAGTACGACGAGGCTCGCGCCGCGGAGACAgccagcgaggacgagctgacGAGGGCcgcggaggcgctggcctgcggtctccagcgcctc
gatgtGGACGGGCAGACGGACGGCAATGAGGCTGCAACGCCTCAAATAGAGAGCTCTCTGGTGGAATACCACGCCAACATTGGCTGCTACCAGTGCTATC
TCTTCCTAgacagccaccacgacgGTGACAAGGCGCAGACGCCCTTCGACGTTGCAAAGTTCGGCGTTCGCGTGGATTTCCCGCGCGTAGAGCTCACGTA
CAGGCGGGAGAGTAATGATGCGCGAGTGTcagagcaggaggagggcgTGGGCGTTGTCTGGCGGACGGAGATCGAGCGGAACGTGGACGTCTCGCAGTGT
ACGGTGGAAGACAAGGAGGATCATTGGTATCTGAGACTCCCGATTCGACCAAGTGACAAGCAACCGCTGGGTGGGTTCTCCTCGTTCACGCAGGTGTCGT
CCTTTGAGCTACGCTCCGAGAGCTACGCGTCGGTGTGCTGTCGAGGGTGCAACGCTCAGTTGCTTGGTGGGCAGGGGAGTACCAGCATTGAGAAGGttct
gccgctgccgtcggccaACTGGATGGACATGTTTGACTTTTGGGGAGCTGGTATTGGAGCTTTCGAGCACATTCCACGCGATGATATTCATGCGCAGAAG
CATCGTGTGCTTGTTGGAGAGTCGTATGTGTTGCTGCATGCTAGTGACTTCGTGGCGGGAACAACGGCGGCAGACCatgaggacgaggccgcTGTTGCAC
CCGGAGATAATGCCAAAGAGGAGCGTGAGTGGGTGCCGCTGGCCTGTGCTGCGTGCTCGGAGCGGGTTGGTTTGTCCAGCGTCGAGCAGCCAGAAACGGT
TCGTCTGCACAAGCACTTGGTTAGCGCTCGTCGGAGCCTGGAATccgctgctgaaggaagcAGCACTGCCCAGGAGGAAAATGTGTTCGCTAAGTACACT
ATCGACAGCATCCTCAGCGCCAAGTTGTTGGAGATGGCAGACTCGGACGGCAAGTTCCGCTTCGTCTTGACATCGTCGGGTGACAAGCATGACCAAGACT
TGACGTGTGGGAAGGAAAGTAGTcatcctcctcctgctcctgccaCCGCCGCTGATGCACCATCgaccgagctgcagctgcaactgctaAGTTGGGAGAC
GatgatccagcagcagaatgaAACCAAGTTTCTCCGCGTCCTAAAGGTTCTGTATGGTCCTCGTCAGCCTATGCCTGCTATACCTGGACTCCTGGCTTCG
CACGAAgtgtcgctgccgccggccATGTACTCGGCCATCGCCAAACGACTTCAAACCAGCTCAACCCTGCTGCCGTCTTCGTTGCGGGCGTTTAACCGGA
TGAATGTCGGCTATCTCTTCGCTTAAAGTGCCGGTAAGAACCACTTGAGCAAGTCAATACGAAACGTACAAGTCAAATGCAAAAACTAACTGTATTATTC
CTACACGTCTGCACAACGCGTTCTCGTGTGAGCAAGTGCAGCCGCTTACTGGGCTGGCGCCCAGTAGTCCATGATGTCGAGGGCCACCTCGCAGCTCTCA
CGAACGACCTTCACGTCGTCCTTGAGGTACTGCTTGAGGATCTCCTCGCACTCGGTCGTGCCAATGGCTCCCAGAGCCTCCGCGGCCTCGTGACGCACCA
TGCGGTGCTCCGtctcatccagcagcaccttcttgaggGCCGGCACGAGCACGGGGTTCTCCATCTGGCCCATGACGTAGGCCACCTCGTGCTTGAAGAG
CGCGTTCGGGTCGTCGAAGGCCTCCGCCAgggcgagcgccgcctcctccgtgttGCGGTTGCGCAGCGAGAACATGGCGCGGTACTTGGCGAACATGTCG
CCGTTGTGGTCCAGCAGGACTCTGCGGAGCTCGGCCGTGGgcacgtccttctcggcAGCCGGGGCCGGGTCCTCGGACAGGTACGGGTTGCGGTCCACCT
CCCcctccacgatctcgcccttggccttggccaccttgtACTGCACCAGACTGGCCGCCAGCTTGCACGTGTCGGAGACCTCCGGGGCCGGGTCGGCGCT
GAACTTGTCGAGCACGGGCAGCGACTGGGCCGCGCCGATGGCGCCCAGggcctcggccgcctcgTGGCGCACCATGCCGTCGTCCGTcacgtccgccagc
acctgaTGCAGCGTGTCGCAGGCCTCCTCCATCTGGAACTGGCCGATGACGTacgccagctcgtggcgcaTGAGCTCCGAGTCCTGGcggtcctgcagcg
ccgtcagcagcacgcggaggtcctcgaggccgccgcgcgaGCGCAGGTAGAAGATGGCGCGCGTGCGCTTGCCGACAGGCTCCGACAGGTCCAGCAtcgc
gtcgcgcagctgctcgaagcaCGGCGCCGAGTCGGCCACGGTGGCGATGGTCTCGGTCACGGACGAGTGCGACGGCATGTTCGCTTCAGGGGGCAAGTCT
GGGAATGGCTACGTCAAGTGATAGTCTTGGCCAGTCAAACAAGAAGTTCTGGGGAAAAAAAATGCGGTAAAATATAGGCGATTAAGAAAATGTAAAGTGC
CTCGAGCCAATAGGA