Description :
From Genome Similarity Track
Location :
Scaffold_880:9350- 12406
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_880-fgenesh-gene-0.0Phospholipid-transporting ATPase

Sequence
3056 bases(100 bases per row)
AACGCGGCACTCGAGTACTGCAGCAACACGGTCGTGACGTCGCGCTTCACGGTCTACAACTTTTTGCCCAAGCTGCTCTTCTACGAGTTCAGCAAGCTCG
CGAACGCGTACTTCCTCATGATCTCGGTCATGCAGACGATCAAGCCGATCTCCAACACGGGCGGCTTTCCGGCGTCGCTGCCGGCGCTCACGATCATCGT
GCTCATCGACATGTTCTTTGCGTGCCTCGAGGACTACAAGCGCCACAAGGCGGACAACATCGCGAACGAGCTGCCGTGTCTGCGCTACTCGCTCGAGGCG
CGCGCGTTCGAGCAGTCCAAGTGGCATAACCTGCGCGTCGGCGACATTGTGAAGCTGTACAACCGGGAGGCCGTGCCAGCGGACCTCGTGATCCTCGCCG
CCTGCGAGCCCGAACCAGAGAACCCCGTGGGCATCTGCTACGTGGAGACCAAGTCGCTCGACGGCGAGACGAACCTGAAACTCCGCCAGGGCATTGAGGC
CACGTACACGACGCTGCTGAGCGACGATCAGGTCGCGGACCTTACGGGCGTCGTCATCTGTGAGACGCCGAACAACTCGATCCACCGCTTCAACGGCTCG
ATTTCGCTCAAGGACGGCAAGAAAGAGGCGATCACGACCAACGCGATCGTACTTCGAGGATCGACGCTGCGCAACACGGAGTACATTTACGGCCTCGTGG
TGAACACTGGCCCCGACACGAAGATCATGATGGCATCTTCGAACACGCCGATGAAGTGGAGCAACATGGAGCGACGGCTGAATCAGCAGATCCTGTACAT
TTGCGCGCTGATGGTCGTGCTGTGCCTCACGGGTGCGATTGCGTCGAGTGTGTGGAACCAGTCGAACCTGAGCAGAACCCGTGGCGAGAAGGCGTGGTAC
CTATACGACCGTCACGCCACTGCCGTGAGGGCACCAGTGGGCAACTTCGTCATGCAGGTGCTGTACTACTTCCTGCTGCTCAACTCTTTCATCCCCGTGT
CGCTCTATGTCAGCATGACGTCGGTGAAGTTCATGCAAGCGTATTTCATGAACAACGACCTGGAGATGTATCACGAAGAGTCCGACACGCCATTTCAGGT
GCGCACGATGTCGCTGAACGAAGAACTCGGTCAGATCGACTACATCTTCAGCGACAAGACGGGCACGTTGACGTGCAACATCATGGAGTTCCGCAAGTGC
TCGATCAACGGCGTTGCGTACGGAATGGGCGAAACCGAGGTCGGTATCGCAGCCAAGAAGCGCCGACAAGCAGAACAGCCGGGTCGCGATGGTCTGGTGA
TCATGGAAGAGCGCGAGGACGAAGCGAAGAACGACGCCCGCCACCATCATCGTGAGGTGCGAGCGCCGTTTGTGAATTACCAAGACGACGCGATCTTCGA
TGCGCTCGCTCGTGAAGACAGCACTCAAGCCGACATGATCAATTTGTTCTTTGAGCACTTGGGCATTTGCCACACGGTCATGCCTGAGAAGGCCCCAGAT
GGAAGTCTCCGATTAAGCGCATCGTCTCCGGATGAGCAAGCGCTTGTTGCGGCCGCCGCGTGCTTCGGCTACAAATTCGTCGCGCGCGCGCCTGGCAAAG
CCATGGTCGAGTATTTCTCGTGCCTGGGTGATCAGGATGCGGGGCTTTCAACGCAACCGGTTCAGGGCAACCAAGTCAACTCGTATCAGGTGTTGGAGGT
GCTGGAGTTCAACAGTACGCGCAAGCGCATGTCGGTGATTACGAAAATGCCCAATGGCAAGTTGAAGCTGCTCTGCAAGGGCGCTGACACTGTGATGTAC
GAGCGACTGCGCGAGACGACGGACTCGCGCGTCCTTCAGATGCGAAACAAAACTCTTCAAGACATGGAGCTCTTCGCGTCTGAGGGTCTACGAACGCTTG
TGATCGCTGAAGCTGACGTGGACGCGACATTCTACGAAGGCTGGGTTGCTCGCTACCGCACTGCGATCAACGACATGCGCCAAATTGAGCTGAGACGGCT
GGGCGAGAAGAACGACATCGACCGCTTCATGGAGGAGATCGAAGTGAACTTGGAGATCTTGGGTGCGACCGCGATTGAAGATCGTTTGCAAGCTGAGGTG
CCGGACACGATCCACAAACTGCGCCAGGCGTCGATCAAAATCTGGATGCTGACAGGCGACAAGGAAGAGACCGCGATCAACATCGGTTTCGCCTGCCGCC
TGCTTACTCCTGACGTTGAGCGCGTGGTGATCTCGGCAGACACGCATCCCGACTTGGAGGCGATTAAGGAGGAGCTCGAACGATACAGCACTGTGCGCGC
GAATGCCGAGAGCGACGACGACTACAGCAGTTCTGGTGATAAGCAGACTGCAAGAAATTTCCGAGAGTCGACTGTGACACCGACAACGGAGGCGTCTGAT
GACCGCCGGCCGCTGACGCGAATTGAGAGTATTGCGCACATCAACTCGACGCAGGAGGAGCTGGGACTGGTGATCGATGGCGAGACGCTCGAGGTTGCGC
TTGAAGAATGCCCCGAGCTGCTGCTGAGCGTGGCCGAGAAGTGCGTTGCTGTGATCGCCTGTCGCGTCTCTCCTGCCCAGAAAGCTCAGTTGGTTCGTCT
CGTGCGTGACAACACCCCAGGCGTGCGCACGCTCGCGATTGGTGACGGCGCGAACGATGTCTCGATGATCCAGGCTGCTCACGTCGGCGTGGGTATCTCT
GGCCAGGAAGGAATGCAGGCGGCGAACTCATCGGACTACGCCATTGCGCAGTTCCGCTTCCTGTCGCGCCTGCTGCTCGTGCACGGCCGCTGGAACTACG
TGCGCATGGGGAAGCTGATCCTGTACATCTTCTACAAGAACGTGATGATGAACCTGACGCAGTACTGGTACATGATCTTCACGGGTTTCTCGGGGCAAAA
GTTCTTCCTCGAGTGGGGTCTGCAGGGCTACAACCTCTTTTTCACGGCGCTACCGATCGTGCTCATCAGCACGTTTGAGCAGGACGTTCCCGCGCACTTG
GCACACAACTACCCGCTGCTCTACCGCATCGGCCAGGAGAACAGCAACTTCAACAC