Description :
From Genome Similarity Track
Location :
Scaffold_3379:935- 2562
Sequence
1627 bases(100 bases per row)
TCGGTGGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGAATCGCGACCACGCCTATCCTCCGTCACTTCGATCCAGAACGTCAACCTACGGTA
ATAGTTTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGA
ATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGCTCCT
GACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATT
GTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTA
AGAAAGAGCCCAAGCGCCGAATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGCGTTTCGATGGATCCGCTCGCATACTACG
CGGAGGCGGGGCGTACAGTGCGATACTGTGGAGACTACCTGGATGGGAAGTTGTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCG
GAGTATAACGGGCTACTGCTGGTTTTGGATCTACTAAAGGGACAAGATCCGAAAAGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGC
GAGGTGAGATTGACTGCAAGGCGCCGGCCCTAACACTGTTACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAA
GCGAGATTGGAATGCCAGTGCAGATAGCTTGGCCAGCGCCGCTTTACGGAATCAATGTGGTGTTGTAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTT
ACGTTGAAGCGACTAGACGAAGTGGTGGTAGTTGGATCCAGGAAAAGAACAGTCCAGGTGATGGTCGTCACTAGGCCCAGAGGAAGGATTGGATCCAACC
CTTAAATTCTCGAGGAAACATTTGTGAAGAGAGTCCGCATCGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGAATCCTAGGACTAAAGAAGTATCT
GATGGGGGATGTACGGGATCTGAGTCGGGAAGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGC
CCCCCTACGAAGAGAGTCAACGAGGAACGGGATAGATTGATGAGGCTGGTGATACCGGAAACCTTACAACAGGATGTCCTACACCACTATCACGCTAGCT
TGGAAGGCGGACATCAGGGTATTGGTCGGACCTACCAACGGATCCGGGAATGTTTTCACTGGAGGGGACTATTCAAGAGCGTACAACGGTATGTCGGGGA
ATGTGTGGATTGTGAGACAAGCAAGGGCAGGCCCACAATCGAAGGGGGGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGAT
CATATCCCCTCGTTGCCCAAGTCGTTC