Description :
From Genome Similarity Track
Location :
Scaffold_680:935- 13102
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_680-fgenesh-gene-0.3Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_680-fgenesh-gene-0.1Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_680-snap-gene-0.11Mycorrhiza-induced NACHT/WD-repeat protein
Pytve_DAOMBR484fgenesh_masked-pve_contig_680-abinit-gene-0.21Brefeldin A-inhibited guanine nucleotide-exchange protein

Sequence
12167 bases(100 bases per row)
CTCCTCGCCGCCCACGAACTCGTGCAGCTGACGCTAGAAACCTATCGCGGGCTTGTCTATTGCGTCGTTGCCAGCGGCGTCGCAAGGTCCACGCGCAGTG
CTGCAGACAGCCAAGCAGATTGTCAATGGGTGACAACGTCCAACACGCTCAGGCGAATACACCACTGACCTTTGCGTCGCATCAGCTTCTTGTCCTTGAG
TTTCTTCTTCCGCTCAAGCTCCTGCGGACACAGCGATGAACACCAATACTCGACAATGCAAGACAGCAAAGCAGTAGCACTGGCTCACCTTTCGCCGCCG
CATCGTTGAGGTGTATTTGCTGAGGGTCGCCTGATTCGCCGCGTCTTCCTGGGACAGCCATGGTTTCTCTCTGACCACGCAAGCGCCGTTAGACACCACC
GCCAACGAACACGGTAGCAAAAGCGAACGCGCCTGTCGAGTCGCCGCCGCAGCGTGCGCTTCGCGTCGTTCGTTTGCCGAATGATGGTGTGTAGCTCGGA
CTGCAGCGCGCGGATCTCTTGCGCGACCTCGTCGTCCTCGGGGTCGGCCAAGCAACGCTGCGTCTCGTCAAAGCCCATCTCGAGCAGACCGACATCCCTC
AGCGCGTCGAAGATCCGACTGGGGTTCCACGTCGCAGCGAACTGAGCCGCCTCCTCCTTGAGATTGTGGTGGCGTTGTGGAGGCTTCATTTCCTCCTCCT
CCTTCAGCAGCTCGCTTTCGCCGTCTCTTTCGGCTGACATACCTCCTGATACATAATCAGTATCGCTCTCACTCTCGTCCATTGTGGAGGCATCTGCAGT
CTCCGGCGCGGCAGTCGGTACAGGCAGCAGCGCCGCAACCAATCGCTGCGACCGAAGGAGGTTAGCAATCAGAATACATCGTAGCCGATACTATTCAAGA
GCGAGCGCACCTCTTTCAAAAAGTCGTCCAGCTCGCCTCTCCGTGCCACTCCCTTCGTGTCCGTTGTCTCGGTCGCTCGTCCGACTTTGGTGCTAGAGTC
TGTCTCCTCCGACTGGTAGGATGGAAACGCGTCGCCGTCGAGCACCGACCCCTCGTCTTCCAAGCGCAGTGCGTCGTCCATGTCGTCGGGCACAATGCCT
TTGAAGTACGAGTACGCGCCGAGATACCGCCAGAGCCCCGTCGTCGAGCACGGCGTGTCTGCTCCACCCGCCAGCACGAGTATTTAGCACATTCCTCCTC
CACCAGTCGGACCTGTCTGTCTCCTTCCGTACCTGCGGCCAGGTCGTCCTCCACCTGCAGCGCGGCCGCGTCCAGCGGGTCCGCCTTGTCATTAGCAGCG
GCCTCGTCCTTCGGTCGCTCTTCGGCCTTCGGCTTGGCCACCACTGCCGCTGCCGCTGATGCTGCAACAGGCGTCCCATTGCGACCGGCGCCAGCCTTGG
GCGGCGGGAACATGGCCGTGGACGAGCCATCCAGAAAGTCCGAGATGGCCACGAGCTGCCGTTCCAGCTGAGAGAGCTGGTGATTCACCTGCGTGCGCGC
GCGCTGCACCACCACACCGTCAGCGTCAGTTCTGTCCTTATGTGCGCCGGCGGACCGACTCTACTTGCCTTGAGCTCCTGCGCGGCCCGCGTGAGACCGC
TCCGCCTGGCGGTCGCGAGAGCCTCCGGCGCGCTCGCGAAGCTCTTCACGGCCGCGAACTGCTCGTGCGCCAGCCACGGCACGCGCAGTGGCGGCTCGCC
CATTGCTGCCTCCGGTCGGCGGCGCGTGCTTGCTCGATGCCGGTCTGCTCGAACACGCTGGGGAAACGCGCGTACCGTATCGAGTCGACCGAAAAGTACG
AATATTCTCTGACATTTCTCGACGATTTCGACGCTGCAATTGATGACAGCGAGGTTCAAATCCCCCTTCAAAACGAGCGGGAAAAAATTGGGTCTGTGGT
ACAAGGACCCAAAAAACCTTGTTGCCGAGGTTTTCCGCCGGCTCGTCCCCCCCACTCCAGCAAAAAAGCGGGAGGCCAGTAAACGAGAAATCGCTGGAAA
GCCGCGAGTACCGTCGGCGCTTACCGTGCGTGCGCGCGAACGCGAGCTTTGAAAGGCAAGTCGAGGCGGCCATGGCGCGCGGCAAGGCGGACCGGCAGCT
GACGGTGGGCAAGAAGCTCGAGATCATCGAGGAGGCGGAGCGCACGGGTCTGATGGCCGTGACGGCGCAAAAGTACGGCGTCAAGACCGGCCAGATCCGC
GACTGGAAGAAGAACATCGACCGGCTGCGCGCCACCGACCCGTCGCGTCTCGTGTGCGCCAGCACCGTGCAGCGCGGCCACCTCGTGTTCAACGAGACGT
ACGCGCAGTACTGGGTCGGCTACAACAAGTACTGCTCCTCCAACACCAACTTCGACGACCTCAAGGACGCGCTGCGCACCACGCAGAAGGACGTGCTCCG
CGAAGGCGTCAGTACGTCTGCGCGCGCGTGTCGCTGTCTTGATCGCTGGCTGGCTCGGTGCTGACTCGAGGCTGCTCGCTGCTTTCTATCACTGTGTTCG
TGTAGATGGCTTCGGGTTCCCGTCCACGATCGACCCGACGGCGACGCACGCGCTCGAGAGTCCGCTGATGGGTGAGTGGAGTGGAGCCATTCGGTGGTCG
TGGTGACATGTCGGTGCTGACTCAATGCTGACATGCGACCTCGCAGAGAGCCAATTCTACCCGCCGGGCATGGAGAACAACCCGTACGACGTCATGAAGA
AGGACCTCGTGACGGTGCGCGACCAGCTGCGCGAGTTCTTCGACCAGAAGGCGTTCCCGACCAAGTACCTCTACTACGTGACGCGCATCGACTTTTTCAA
ACCCGACCCGAACGCGCACTCGGACGAGGAGGACGAAGACGAGAACGAGGAGAGCCAGCCGACTGCCGCCGCCGGCGCTGCGTCTGGCGCGGACAAGGCT
CCCGAGACGACGGCTACGGCGGACGGTGCTGGTGCGCCTGCCGCTGCAGCTGCTGGCGCCGACTCGGCCAACAGCATCGACAACGTCGTTTCCTTCTATG
TGGCCATCTGCGGGAACGGCTCTGTGATGGTTCCGATGGCCGTCTTCCCGCCGGTGGAGGAGTGGCACTGGGAGCGCAAGAAACCTGTCAAGCTGCGTCA
CGCGCACAGTGTGCACCGCACGAAGCGGAACGACCCGAGTGAGGCGCTCCAGTTCTTCTCGGTGGTACGTCTCTTGAATGGATGAGCGGCGATGGTGATC
CGAGCGGATACTCATTTTACTGTCTTGGTTGCTCTCGAACAGACTTGGAAGAAGTTTTACGACGAAGAGGCCAAGTACAGCGACAAGTTCGCATTTCTGC
TCGACAAGAGCATCGAGGAGTTCCAAGCACCAGAGTTCACCGAGGGGCTCAAGCAGCTCGAGGGCTACGGCAAGTACTGGAACACGTTCTTCACGGTGCG
CAACCCGCTCGACTCGTCCAACTTCGACCACGTGCTCTCGACTTTTGTGATCGAGGAGTGGCGGTCCATCCTCCGGCTCAAGAAGTCGAGTCAGCCGAAC
GACTACCGCAAGTGCATCGCCTTCTGGTTCTACTCTGCGTGGGAGTTGTTCGCGGGCGACAACGCTCGCACGGCCTTCCGCAGCAGCAACATGTACCTTG
AAGACAAGGCCGTGTGCTCGACTGATATGGACGGTCGTATCGTGTAGCGCGCTGAAACTCGCTGCATCTCCAAGTCTGTGTTCTTGCATTTTCACTCCGC
TCGAAAACGCTGTTTAGTTCGGAAAACGATTTCGTGAGGAGTGTGTTGTTCACTTGTATTTCGTGCCTTTCGTCGTGGTCACTCGTTCTCTCCTTCGCCT
TCGTCGCCACCATCAGATCCGGCTTCGTCACCCGACTCATCAGGTACGTCCGAGTCGGACTCGACCTGCTCGCTCTCTTTCTTTTTCTCCGTCTCGTTGC
CGCCACCGCCGCCCTTCGATTCTGTTTCCACTTTGACATCGTCGTCGAGTGGTGGAAAGTACTCCTTGGCCAGCATCGCCATGCGTTGAGCGGCCCATTG
ACCCTCAACGTCGGCCGCTTTCGCCTTGTTGGCCATGACAAAGTCGAGATCCTCGAAGGACAGCTTGCCAAACACGACTGAGCTCGCGCGGTCCAAAGTC
TGCAGCTCGTCGGAGGCATTGCCGCCTGTGTCGACCTCCACGATCAGTTTCTGACCCAAATACATGTTGGACGAGTCGGGCAGTCCATTCCATCGCAGCA
GCTTCTGGATGCTGGTGCGGTACTTGAGCGACAGCGACCGCAGCGTCTCGCCAGCTCCGAGGATGTGGTACTTGTTCCTACCCGAAGAGCCGAGTTGTGC
CAACCAGTACCACAGCCGCAACTTACCGTCGGATGACACACTGACGAGCCGCTTTTGATCGAACTGAAGATCGAGAATGCCAGCCTGGTGGCCGTGAAGC
GTCTGCAGGAGATTGCCGGTGGCGAAATCGATCACGCACAGATCGCCACTGCTCAGGCCGACCACGATTCGCGTAGCGTCAAACTGGAGGCAAGTCACCG
CTGTGTCGCGCTGCACGTCGCAAATGCGCAGCAGCTTGTTGTCAGCATCGAGACTCCACACAATGACTCGTCCGCCCGTGTCGCCGCTCACAATCTCGTT
CGCCTCCTGCATGACACACGTTATGCTGTGCAGGTGTCCGTTGAAGTAGGTGTCGCCCTCTCGCTCGGCCTCGAGTGTGCACGCTAGCTTCGCCCGCCGC
CGTGCTGCTGTGGTGGATATTGGGCCAAACTCCCACACCTTGACGCGCTTATCAGCCGCACCTGTCGTCACAACAGCTCGCGAACTGTTGACAGAGAGAG
CCGTCACTGTCTGGGTGTGCGCGCCGATCATTCGCGCGATGAGTGCGAAGCTGTGCGCGTCGAACACGAAGACGTCGCAATCAGAGCAACCGCAGACAAT
CCAGTCCTTGTCTGCAGCAACGCTGACGACAGCTGCGTCAAACTCGTACAGCATCTTCGTCAGCGACACGGAGTATCCCCCGACGAGCTCGTCCTTCACG
TCCCAAACACCGAGCGACGCCTCCATCGAGCCCGTGTAAACTTTGCGACCGACGTAGCAGAGAGAGATGATTGGCGCCTGGTGACCTGTTGGATCGCCAA
GGTGCTCTTTTCGTGGATCACCGAGCGCTTGAGCTAAACACGCGCCAGTCAACAAATCGAACAGCAAGCCAGTCATTCCTGCCGTTGCAGCACACATCGG
AAAGCCGCCACTGGCAGTCCCAACGACATTCTTCAAACGCTCATTGGCTGCATTGAAACTGAAACACCGAAGCTTCTCCTTGGACATCATGCGCTGCATG
AGCGCTCCAGTCTCCACGACCAGCTCCTGCTCCAGTTCTTTGATCTCATCGTCCGCGTTCGACACGCGGATCTTGGAGTTCGCAATCTCCTTCGTGATGT
GTTCCTCGCCAGCTCGAACAACCCCCATGAGCTTGGCGAGTTTCTGCTTGAAGCTCTCGATTTCGTACCGCGCGCTGGCGCCAATGATAACGCACGAGTC
GACCTCGGTCGAGTCGCTAGCGAGCGCGCGCTTCAGGTCCTCTTCTCCCTGAGCAAGCAGCTTCCTTTTCTCAGCGAGCAGTGTGGTCATCCCTTCCACG
AACTTGAGTTCTTCGCGCACCACCAGCTGGCGACCGATCCTCTCTTTCCGCAGTCGTGGGACAATCGCGCCAACCCGCTCCAGCGTGATTTCGCACGATG
ACTCGGCGCCAGCACCCACAATCCGCTGCTGAAGCCGATTCAAGTGCTGATTTGCTGACGTAAGAGTGTTAGCAAGCGCAAACTCGATCTCATTTGCGAG
ACTTCGGTTAGTGTCCTCCATTTCCTTGTCACCGAGTTTGCTGTAGCTGTGCTGAAGCCCTCGATAGCATTCCAACTCAGCCTGTTTGTCTCTCAGTGCC
TCGAATGACAGCAAGGCACGTTCGTAGCATTCGACGCTAGCTTTGAGCGAGCGCATCTCGTAGAAAGCAGCGCCTAGCCGCAAATCTGCTTGGCCATGCT
CAGATCGCAGACCAAAGCGAGACGCGAGTAGAGACGCGCGCCGAAAGTGGGCGAGAGCATGCTCGAACTGCTTCAACTTGAATGTTGATTCGCCGATATT
GAGGAGTAGTTTAGTGAGCTGCTGAGGGCTCATCATATCCACCCACTGCGCGTTACCATACACTCCTTGGTACAATCGAAGAGCACTCTCATAATCTTGG
AGCGCCATTCGCGAGTCTGCCTCCACCAGCACTGAGGCGCACTTGTCGAACTCGAGTTGCGACTTCGGACGCGAGACGTCATTGCTACTAGTATTCGCTG
AGTTCGACACTTGTCGTTGTTGGTCTCGCATCCACCGGACATCGTCCAGCTTGTCGTCAATTCCCCGAACCTGCTTGAGCAAGCTCTGAGTTTCAAGAAG
CAGATCGTCTCGGTTCATGGCAGCGCTCAGCAGGCTCACGCTTCCGATGCCGATCAGATCGTCGGTGCTGCCGATCTTCGGCCCATCACTCGCGTTCACG
ACAGCAAGCCATTTCTGCAAAGCCTTCCGTAGATTGTACTGTTTGACTCGGAGGAGAGCTCGCTTCACCATCGCGCGCTGGTCGATGTTGTCTTGTCGAT
TCTTTGCCAGCGTCAAGAATGAGCGATGCAATAGGCCGTGCTGAAGCCGCGCCAGTGTTGCCACCGCTCCACCATGGTTGGCGGACGAGTTGGCGGACGG
GTTACGCTCGAAATCTGTAAGTGCGAGTCGCCGCTCTTCAATTCGACGCACCACTGTGGAGCGACGCTTCTCGTCCGCGCGCAGGTAATTCTCCACCTTG
ATCATCTCGGCCTTCGCGTCAACAATGTAGAGCTGGTCTATCTCGATCTCGTCTTCGAGCGCGATGATGAGCTCTTTCGTGTAAAATCGCTGGCGTCCGT
TCTCAAACACGTCCGAGTCCATCTGAGGACCTCGGAACATTCGTGCTCGCTCGAGCTCTGCCTGCTTCTCCAGAATACGAGTTTCTGCCGCCCGGATCAA
CGCAACAAGGTCAATCCGTCGATCCGCACACCACTGAACGTTGTATTCGGCCTTCTTCAACTCGCTCTGCAGATCTGCGATCCGAAAATGGAATTGGCGC
CGACGCTCGGCAATCTTCTCATCTTCTGTCATGTCATCGAACTTTCTCACTGACACTGGCGGTGCTTCATCACCTTCATCTTCGACTGTATTATCCTCTT
CAATCTGCGGCTCGTTCGAACCCTGCAAGATGGCTTTGACTTTTGCCTCAAGATGTGGGTGTGCGTCCACGATGCACTTTGAAACAAGCGAGATGTAGTA
CTGCCGTTCGTACCGCTGCATGAACCCACTCAGAAAAAGCGAATCGATAACGCGCGATCTTGAATTGACAGCAGCTTGCAACTCGTCGAGCAGCTTGAAC
TCGCTGCCTGGAGCTAAAGACAATGCAGGCAACAACGATCAAAGCTGTCAGAAACCAGTCTATACGAGCATCATAGTGCTATGGGAGACTGCCTACCAAT
GGTGAAGATCGATTCGATGACATTGGAATAGTCGCCAGGTTTGCCGTCGCTGTTGACTGCGCGGACTTGGAATTGCTTGTGTTCTCTTCCGCTCAGCAGG
TTTTTGATCGTGAACGTCGTCAGACCCGAGTACGTTCGCATTCGTCGCGGTCTGTACACCACGTCCGCCATGTTGAGAGATTCGCTCTCATATCTTGTGG
CCACTTTGTCTTCTATCACTGCTTCCACGAACGCAATCTCGTAGTCTACGATTGGTTTCCCACCGTTGTCGTGCGGCTCGAGCCACGATAGCGCCACCGA
GTTCGCAGTGATCGCTCCGGCAGAGAGAAAGAGGGGCTTCGTGGGCTCGATAGACGGCGCCGTCTTGACCAGTTCGACAATATTACTAGATGCGCTCTTG
CCGTTGACTGTGATTGCAGAGAGAGAGAACTCGCCATACTCTTGGTCAGCTTCTAGTCCGTCCACGCGGAATTGATTCGGTGCAACGGGAGTTTGAAGAC
ACCACCTCGACGTGAGCAGCGGGACCATCCGCTCGACAGTTTTGTCCCCTTCGTCGTTCGATCGATATACGGAACCCCGAAGTTCATAGTCTACAATCGG
ATTTGAGCCCGTGAAAATGGGTGGATCCCACGCTAGTACGATAGAGTGGTGATCGACTCCATGCTCCATTACCCTCAGAGATCTTGGCGGCTGAGACACA
AACCGCGGTAGTGCACCGCGCTGAATACTCGGTAATACCACAGAGCTCGATGTCGTCGACGAAGAAAGCACGGAGTCTGTCTGTCGTCGAGCACTGTCAC
CTTGTTGGTTGCTCTGCTCGATTGTCGGGAGTCCGATGGCCACACAGTTCTCAGCGTGCTGTTGCATCAATTCGGGTAGAAAATGCGACCCGCAGGTTGG
ACAGCGCGCAGCACCAAGCTGCTGCTTTCTGATATCTTCGTCCGACCGGATCCTCGTCTTGGCGAATGCCTTCTCTAGGGACTCGTCGTGCAACGCTCTG
GACAACCGGAGCACTCGCCGATGCAAATCGTCAAGCAGTCCGTGCTTCTGCCGAACCTGCAACTGCGCCGCAGTGATATCCGAGGCCAACAGACTGTCGA
GAGCAGACGAGTACGACTACAGTTAACGCTTTTCACTAGCAGCGGATCGTAAAATCATGGACAAGAAGCCTACCGGACTGCACTCTCGGCCGTGAATTGC
TTCCCGCACGATTGGAGCGTCGCATTGTGCCTCGTCTCCACGCCGAGGATCTCCATACGGATGTCGTGTGCCTCATGCTTGGCACTCACGAGCTCCGGGA
GCGACACACTATGTCCTCGCGTTCGGTCAAGCGGAGAGATCACCTGCTGGGACGACCGACCTGCCGACGGAACCTGCAGCGGTGTTAGCGACTCGTCCTG
GCCGATCGGAGTGGCTGCCACAGCTGCATCAAGGCGGTCGCGATCGTGTGCGGCGCGGAGACGGTTGCCGACGCGACGGCGCAGCTCACGCGCTCGCCAG
TCGGCGTCGCCGGGAGACGCCATGTGCCTCCGCCGGTCTGCATGACCGACCACCTCGGTTTCCCCAGTTGACCTCCGGCCACGAACAACTTTCAAGCAAC
GTTCGGGCAACTCCAACTTCAACTTCACTCCCTTCAAGCAACTCTCGAGCCATTCCCACTTCAACATGAGGGATCATCATTCCTTGACCTCCGAAACCAA
CCAAAGGCGAACCGCCGCCGCGCCAGCAGACTCGGCGATCTCGGATGAGTATGCTCGCGGCATCATCCCCCAGCGAGTCCGCGCCGGCCGCGCGGCTCCA
GCTGGAGCTCACGCTAGAGGAAGACGACACGGTGGTGAGCGACAGCGCGGCGTCGCCGCCTCCGTCTCGGCGCGACAACCCGAGGGAAGCGCCACTGCGC
GCGGCCGTCAAGGCCATCCAACACGAGGCCGCGCGCGACAAGGACGCGTTCGAGCTGCTGCACGAGGTCTGCCAGGAGACGCTGCAGTGCCGTGCGCGGC
TGGCAAAACTGTACGCTTTGGCGCCGCTCGGCCGCGCCAGTTCCAGCGTCGAGAGCGAGAATGATGGCGATTCGACTCCTTTCGCTGCTGCGTCAGCCCC
CAAGAGCCCACAGGAGCGACTGATGGCGCTCGTCCCGACGGCGATCGACAAGGGGAAGACTCGCTACCACCGCCGTGCCGCACCAACGGAGTAAGCAGCT
CTGTCGCGATGATGATGATGGTGTCGGTTGTGAAAGCAAACTGATTCGATATATCCTGCAGGGTCGGAGCGGATGCAAGCCCACGGTGGAGAACGGTTTA
CGGAGACACGAGACCGATCACCGACATTGCCGTCATCTTCGCCAGTGACATGGTCCCTGAAGGATACATAAAGGTATGTCGCGCGCACGGTGGATCTCAA
CATTTGCATCATTGACCATGCACTGGGTGACGACGCAGCTGGAGCGATCGCCGAGTGGCACGCGCGCCGACATCAACAGGGGAGCGCGCGGAGAGTTCGT
CTACCTCTGTGTGAGCAAGGACACGGCCAGCAGCAAACCCCCGGTCAGCGACATCATCGCGATCTTCCCTGAGCGCGGCGAGTTTGTCCCGACCGACTAC
GAGTACGTCACGAGACGCGGAGTCCCCGCCAACTTGAACACGGTACGCGTCTTAGCAATGTCCGAGGGTCATCAAGTCTATGCATCTAATCGCACTATCA
TACAGGGCACGCAAGGCGAGAAGATTCACTTGTGCGTCCGGCGGTCAGCAAGCACTTCGATCGTCGACGTGACAATCCTCTTCCCGAAGAAAGGAGACCG
GCTGCCTTACGGGTGAGTGATCCCCGTCCTGCATCAGCGATCGGAGCAGATCGGTCAATGACGTACTGGACGTGCTGGCTAGATACATGAAGGTAGATCA
GACGCCTAATGGCCATGTGGCCGACTTGAACTCCAACTCCGGCGGAACAGAGGTGTTCATTTGCTACAAGAAGAAGGTGAAGCCCTGTGTACTCGAGAAG
GTTGGTTTTCGCGACACTGAATGATGTCGTGCTCCAGTTGAGCTGTCTAGGCGAGCTGCGCAAGGCATGGTTGCACACAACGATGCTCGGTCAAGACGAC
AGCGCTCGGTCACCGAAGATCGCTCCTTACTCGAACGACGCGATACCGCTGCCAAAGGTGAATGTGGACGAGAGTCCAACAGATCCGGCTGGAAAGCTCA
CAGAGATGAGGGACATCGAAGTTGCTGCCGCATCTTCGTTGCCGGACGTGACGCCATGTGAGTGTCCCCGTCCACGCTTGACTTTCCATCGAACGATAAA
GCCTAACCGATTGGTTTTTGCCTCAGCTGCGTCGCTGGAGTACTACATGTATCCAATTTTGCTAGCCTGCTACACGCGGCACGGACCGATTGCAGAAATG
GCATTCCAGGTGCTGGGACAGTGCCTGGATGCCGGTCTGTTTGACGAAGCAAAGTCCGATTTCAGTTCTTGCCCCCTTGGGGTGGTGATTGACGGCATCA
CAGCCAGTTGCCAGCAAGCAATCAAATCACGCTTCATTTCAGCTCTTCCTCTGTTTCGAAAGGTAGTGTGGGGAGGCAGTTGTGCTGGTGGGTTGCCTGC
TGTTCTGATGACTTCTCTCTTTGCCTGATCGCGTTGCAGGTTATTCGGAAGAACGTGAGCGGGTTCCATCCAGCGCTACTCCATTCGATTTTGAAAGCCT
TGACGTTCATCGGAGATATGGACGCGGCCCTCGTCAAATCTGTCGAAGACGAGCTCATCTACAAGATCATGAACAGATACGAGTCCGAACATATCCAGAC
TCTTTCTGCAAGAAGAATCCAAGACAATGATGGCCCTCCGACCTCCGAGCGGTTGGTGAGGGACTTCATCATGAATCTGATTGATGACGTCAGCTCTGGA
GCCGAGATCGCAGCCAACACCGAGAGTTGCTTGGGAGTATTCAAGGTACGAGCAACACCTGGATGGGGAGACAACGGAGGTATGAAGAGTGTTGAACTTT
TGTCTTCCATCCTCTAGAGTCACTCGTCAATTCAGTCCCCCGCATTCTATGCGGATACCCTCGCCATGATCAACAAATTGGCCAGCACCACGGTAACTAC
CCTGTGCATCCTGATCATTTACGATGTCGATTGCTGACGGACTCTGCTCGGCACATTTTAGCACGAGAAGAACGCGCTTCAATTGATTGTCACGCTGAGC
AAAGTTGTCCACCGTAAAGCAAGCGCGGCTGCGACCACCACAGTCTCTGAGAGCGATCGCTGGTTGGGCAGCCACTCTCTTCGCGCGCTGAACGTCGTTC
TCTTGGCTGCCGGCGCTGGGACAAAGGAGAAGCGACTCTTCGGTCAGGTGGTTCGGCGGTTTATCCTGTCTGCTGTGAACTCGACGATGCTGATCGGCAA
CCACGACGCCTTTCGCGGCAACCTGGCGCTGATCTCGACCCTTTGGAACCACTACCGTCGCCACCTCAAGGTGGAGCTCGCGCTCGTGTTCGAGCATCAG
TTCCTGCGGATACTCTTGAGCTCCGCGCCGTGTGCCTTCAACTACCAGCTCGACATCATGCACGAGCTCATTCCGTGGTTCCAACTCCCGCCGAATGTCG
TCGAGATGTTTTTGAACTTCGACCTCGACAGGGTCCAGCAGCAGTGGAAGATCTTTGAGCACTTGTG