Description :
From Genome Similarity Track
Location :
Scaffold_405:9349- 10639
Sequence
1290 bases(100 bases per row)
AAGATGACGTCCGTACCATGTTTTAGATGTGCACACATTGGTCTTGAGAAAACATATATCTCAATGAGCCACGACGTTTACTGGCCCCGCCAGTATCAGT
TCGTGCGCAAGTACCCTCGGACCTGTGAGGTCTGTCAACGGGTGAAATCTAGTCCTTCCCTTCAAGCCCCGTTGCAGTCTCTGCCCGTCCCAGCAGATGC
TGGGAATCCGTTTCAATAGACTTCGTCTTCGGATCCCCCGCAGATTCCCACAAGAATACTGGTATTCTTGTGTTCGTTGACAGGTTCAGCAAGATGGTAT
ATCTGGTTGCTGTACCCGAATCAATCAACGCATCAGCTTGTGCCTGCGTCTTAATCTAAACTGTCTTTCAGCTTCATGGGCTGCCTTGTGAACTCATGTA
TGACCGATACCCGTGGTTCACAGCCGAGTTCTGGCATATCGTGTTCAAAACACTAGAAACTCGCTTAAAGGTGTCCATATCTGACCATTATGAATCAGAT
GGTCAGACATAGCGCGCCAATAGTCTCCTTGAAGAGACACTTCGAGGGTACGTTCATTCTTTTACGAATCGGAGCTAATTCCTGCCGATGATGGAATTTT
CCATCAACGACTCGGTGCACGCGCCGACGAAGCGCACGCTGTTCTTCGTGAATGGCTTGCGCCATCCGCGTCTACCCACCTTTTTAATGTGTGAATCAAT
TTTTAGGGGGGCTCATTCAAGCAAACGCCAATCCGGATATCACTCGTCACGTTCTGACTATGAGGTCATACTATATTGAAGGAACTCGTGTGTGACGCCG
ATGTCGATCATATTGACTCCGGTAAAGAAGAGGAAAGTAAGAGCTAGGATGCTCTTGTCCACCACGATACTGATCACATCAGCATCACGCCCAGTGAGTC
CGAAGAAACAATCGATGAGGCAACAAGTGATCTTGCTGCAGTGCGTTCCAATAGCACTATAGCTAAAGACAGCGAGTCAGTAGATGAATTCATACTGGCT
CGCGAAACGGTTTTCCGTTTCGTACAAGACTCTATCGCAGAGGCGGTAGATCGAAAAACGAAACGCTCACAAGAATGGAAGGGCAAATGTTATTTTTTTC
AATACGGGTTACTCAGTCCTACTATCTATGGTAAACCTACCTTGACACATAGTGACTAACGTAGGTAGTAACAGTTACTACCCAAGTTCATCGGTATATC
TTGTGTGGTGCGCCGCCTAGTCAATACGTACACAATTAAACTGCCACGTATGTGCACGCATCCTACGTTCTACGTCATTCACCTCAGGCC