Description :
From Genome Similarity Track
Location :
Scaffold_1:934555- 936066
Transcript NameFunction/comments
Aphas_H257_00336Ankyrin repeat and MYND domain-containing protein 2

Sequence
1511 bases(100 bases per row)
GAGTCGTCAACGCGATCGCAAACTCGTACTTGGCGTGCACTTTGGCACAATGTGGGGCGTGCCGTGCAATGTCGAGGCGCTGGCAATCTCGCGAGCAGTA
CGTGACGCCGCACGCGCATTCGCTGGTGCATTCGCATTTGCACACGACGCAGCGAGGCACCAGCGGCGGCAGGGCGGGTCGAACCGCCTTGGGCACAAGT
GGCGGCACCCCAATGGTCGTGGCGATCTCCTCGAACGACCACATGCCATTGTCCAAGACCGACGGGGGTCGTCTACACCAATAGATTGAGTCGCCCGATC
ACGATTTTGAGATGGAACTCACTTTGCACCTAGGTCAAACCCGAGCTGTATGAAGTTCTCGACGTGGCTTTTGAACGACAGCAGGCCATTCACGCCATAC
CTCTGTTTCTTGTAGAAATGTCGTCTACACAACAGTTCGCATGTGAAGGGAAGGGGTGGTTATGAGGTTCAAGTGTACAAGTAGCGGGTCCGGGCTTCGC
ATTCGCGGTACTCTTCGTACTTTTTCGCGAGCTTGGGCATAAACGGAAGCTTCCCTAGCGTTTGAATGTAATGCTCGGCGCGATGAATCCACCCTGGCGG
CCCTGGAAACATGGGAGGAAGGTCATGTTCGGGCGGGATCCACACCATCGGCTTGGCCGTGCATACTTTTTTGTGGCCCATGTTCCAGTGGCGAGCTTGA
CACGTCCGACTGCAGTACGTGGTATTTCGACACCGACTGCATTGCTTGGCGGCACCGTCTTGTTTACAACACACACATCGCATCCTTGTAGCGTCGAGCA
ACCGACAATGGAATTGACCAGGTGCATGCTGTTCGCACGCAATGATGATGCATGTGCCGTTTGTGGGTTTGTCCCATTTTACCCAGGAACGTAATCAAAA
TTGCTAACCAATCAGAGTCCTGGATTTAAGGATCTTGGATTCACTGGCAGTCAATCATGCAGGAATAATGGGCTTTGGTATAAAATAATGAGAGTGACGC
TGGTGCCGCATCGCCTTAGTGTTCTACAATGCTTGGACGTCTCATGAACATAAATCGCAATTCTATGACCGGCTGTTCTCGTTGTGAGCATACATACACT
GGGACGCGTCACCTTTAGAAAAAGCATGATTTTCCCAACAAACTTAAGTTTATCCCAAGCGTAGTGGTACTAAGTGGTACTCCGCAGTATAAATCTTCAT
GTAATTAGTTAGTATTTTAATACTACTTTTAATATAAATATTAATATATTTATATTGATAACGTTAGATTCCCAAAAAATCATATAATTCCCTCATTAAC
ACAGTACCACTGCTGTTCTTCTCAGAAAACAATGCAAGTTGCGTGCTTGTACCGTGTAGCGACAGCCATATAGATTTGGACTCCTCTGTAAAATGATATA
ATCCACTGTAAAATTATATAGTTGGATTATTACACTTGATTATTGTATGAATTTGGGAATTTACACTATCCGTATCCGGATACTTGCCCCGCCACTGTCC
AAATCTATATA