Description :
From Genome Similarity Track
Location :
Scaffold_1:934542- 936125
Transcript NameFunction/comments
Aphas_H257_00336Ankyrin repeat and MYND domain-containing protein 2

Sequence
1583 bases(100 bases per row)
CTTTGCCAGTACCGAGTCGTCAACGCGATCGCAAACTCGTACTTGGCGTGCACTTTGGCACAATGTGGGGCGTGCCGTGCAATGTCGAGGCGCTGGCAAT
CTCGCGAGCAGTACGTGACGCCGCACGCGCATTCGCTGGTGCATTCGCATTTGCACACGACGCAGCGAGGCACCAGCGGCGGCAGGGCGGGTCGAACCGC
CTTGGGCACAAGTGGCGGCACCCCAATGGTCGTGGCGATCTCCTCGAACGACCACATGCCATTGTCCAAGACCGACGGGGGTCGTCTACACCAATAGATT
GAGTCGCCCGATCACGATTTTGAGATGGAACTCACTTTGCACCTAGGTCAAACCCGAGCTGTATGAAGTTCTCGACGTGGCTTTTGAACGACAGCAGGCC
ATTCACGCCATACCTCTGTTTCTTGTAGAAATGTCGTCTACACAACAGTTCGCATGTGAAGGGAAGGGGTGGTTATGAGGTTCAAGTGTACAAGTAGCGG
GTCCGGGCTTCGCATTCGCGGTACTCTTCGTACTTTTTCGCGAGCTTGGGCATAAACGGAAGCTTCCCTAGCGTTTGAATGTAATGCTCGGCGCGATGAA
TCCACCCTGGCGGCCCTGGAAACATGGGAGGAAGGTCATGTTCGGGCGGGATCCACACCATCGGCTTGGCCGTGCATACTTTTTTGTGGCCCATGTTCCA
GTGGCGAGCTTGACACGTCCGACTGCAGTACGTGGTATTTCGACACCGACTGCATTGCTTGGCGGCACCGTCTTGTTTACAACACACACATCGCATCCTT
GTAGCGTCGAGCAACCGACAATGGAATTGACCAGGTGCATGCTGTTCGCACGCAATGATGATGCATGTGCCGTTTGTGGGTTTGTCCCATTTTACCCAGG
AACGTAATCAAAATTGCTAACCAATCAGAGTCCTGGATTTAAGGATCTTGGATTCACTGGCAGTCAATCATGCAGGAATAATGGGCTTTGGTATAAAATA
ATGAGAGTGACGCTGGTGCCGCATCGCCTTAGTGTTCTACAATGCTTGGACGTCTCATGAACATAAATCGCAATTCTATGACCGGCTGTTCTCGTTGTGA
GCATACATACACTGGGACGCGTCACCTTTAGAAAAAGCATGATTTTCCCAACAAACTTAAGTTTATCCCAAGCGTAGTGGTACTAAGTGGTACTCCGCAG
TATAAATCTTCATGTAATTAGTTAGTATTTTAATACTACTTTTAATATAAATATTAATATATTTATATTGATAACGTTAGATTCCCAAAAAATCATATAA
TTCCCTCATTAACACAGTACCACTGCTGTTCTTCTCAGAAAACAATGCAAGTTGCGTGCTTGTACCGTGTAGCGACAGCCATATAGATTTGGACTCCTCT
GTAAAATGATATAATCCACTGTAAAATTATATAGTTGGATTATTACACTTGATTATTGTATGAATTTGGGAATTTACACTATCCGTATCCGGATACTTGC
CCCGCCACTGTCCAAATCTATATACGTTACACGGTATGGGAATTAGTACACCGGTTCCACCTCGCCTCTTACTAGGGATTAAC