Description :
From Genome Similarity Track
Location :
Scaffold_197:9345- 14736
Sequence
5391 bases(100 bases per row)
TGATACTTATCTATAAGTTCTCTAACAAGCTCTTAAGCTTTTAGTCCTGGTTCAGGGGACTACGACTCCAAGGAATCACGTGGCACTAATGCTCAATAGT
ACTTGGCCTTAACACAGGCACTGACTCTTGCAACCAAAGACGTCTAAACAAGACACGTGTCTGAAACTGATCGAAAGGGGAACCGAATGTATTTATAGCA
ATAATATACCTCACTTCCGTCTTTAACCTTAAAACTATGCTACCTACTCGAAAAGTCCTCATCGTAGTTCTTCTTGTGTACCACACCAGAACTATGTCGC
CTCTATGAAGACCCTATTACGATAGATATCCTCAAACCATAACCGATAGAGTACGGTATTACCACTTAGCGTATGTGATACAAAGTATGCCTTATCAGTC
AAACTGATCTCGTTATGTGTGTATCACACCCGCGTACCTGGTTATCACAACCATTTATGTAACCCCTTTACACCCTCCCCCCACCAATCTGTCGATACCC
CGAATTGACATTCTTCACCTCTCTCATTGAGATAGCTTGGAGAGAATAGATAACCTCACGGTTGTTTCACGACACCTTGCGCATCAATGGCGAAATTATC
GTATTCCTCCGGGTCTTTGGAAGATATCATACGAGACGAGAACATCGTCGATTATGACAGTGATACTGTCGTTTAAGGGATTGAAACCCCCGAGCCTGCC
ACGTCAGCGTCGCGCTAACCTTCGCGCATTGCGCCAAACCAGAACGATGCACGGCTCAAGCGCTGACTGCGTTGCGTGCTTCAACCACTCTTGATGAACT
TATCATCACCAACAAGCTCGATTAGCAACAGCAACGCTATATCGAGAATAATGAGAGAGCTAGACGTCTATCTCAGACATTATCTATTGTCGAGGCGCAT
TCGGACTATCGCTTCAAGCCTTTAAGCGTTGATAAGTTGGTGTGAAAGTTCGCAGGGCAGCCCTTGAATACTTGGCCCACAGGGCGTGAAGCTACGACGT
CTGACGACATTTCCGAACGAGATTCTATCAGAGAGAGATACTTGACGCCCAAAACGACGACGATCTACGATTATCAAATCAAATTGACGGAACAAGCACG
TGGTGCCTCTGTACCGACGCAAAGAACGGTCCCGGCCGTTCTGTACCCAGGTGAGAGCGAGGACGAGGATGACAGCACGTTTACTCGTTGGGCAAATAGG
GCACGTTGGTTGCCCGACATGAGTGCTCTTCGATATAGTGCCTCCAGGCCGATGTTCGGCTATAGCGTAAGATGCGCTATGAGTTTGCTAATCTAAAGGC
CAAATACCAGCTACGTTCGCTGTATCGCACACAGTACGCGAAACCAGTTGCTATCCAAACCACCACTGTTTCGACTGTGCAGACAGTCGCGGGTCACTCG
GTGTTAGTGGTCGAGCCCTACACCCCACAACTATTGGTGGGAAGCGCGTTGGGGTGCAAGCTGACCCGCAGCGCGACGCTCTAAAACGTCAACGGCATAC
GGGCAATCTTGCCGAAGGGTACCTCAAACTCCCATGAGTTTTCAGACTCAAGGTATCCACACCACTTCACCAGACACTGGTATTGACCTTTGTGACGACG
CCGCTTCAGAAGTCTCTCTACATGGAACTGTAAGTTCCCTTGCTCGTCGATCAACGCAGGAGGGGGTTGATGTGTCGGCACAGGCTCACGAAGACCTGGT
GTCAGAGGTGAAGCGACTCCGAGAGTCTTTTGCTCACGTGCAGACGGCACTGGATCATTCCGTAACAGAGAGTAAACAACTCCGGGAGATCCTCGACCAA
GTGCAACGCGCTCGTGAACAGTCATCGACTGAGTTGGCTCATTTTCGTGAGCACCGTCTCGGTTCGATCGACTCGGTCGACAAGCGACTGCGGAAAATGG
AGTACAACCTGCCACAGCTGGATGGCCAGGTGGATCTCTTGACGAAGATAAAGATAGCGGGGACGACGCCCCACCCTCAGGAGCAAGCGCTTTCCGGTCT
ACGAGAGAAGGATCATGATATGGCTTGAGCAAGCCAACGTAAAACATTGGGTATGTGCGCAATGACAGGGAGCATCGAGCTCCAAGTCTTAGGAGACTCA
GCACAAACACTGCAAAGTTAACGTCGCCAATGAAGCGATTAACTCGCTCAGTCTGACCATCGGTCTGCGGATAGTCCTCTGTAGACATGTCCAATCCCGT
GACAAGCACCTTGAAGATGGAAGTCCAAAATTTGCCTGAGAAGAGAGGGTCACGATCAGAGATGATTGCCAGCTGAAACCCGTGTTCACCAAAACACGAT
CGATAAACAGCATAGCTGTACCTTTTCCATCGATGGAATCCGGCGCTGCCGCTAAGTGAGCCATTTTGCTTAAACGGTCAGCAAAGACCACGATTCCCGT
ATTGCCGTCACAGTCTTTGGGAAGATCAAACAGAAAATCCATACTGATCGACCCCCAACACCCCATGGGCACAGGTAAACTGGCAAGTGGCGCAGCCGAA
TGTGCTAAGGGTTCGACCCGCTGACACGTTTCGCATGTACGCACGTATGGGCTCACCCATTTGTAGAGTTTGGGCCACCGGTAGTATGGACTCACAGAGC
CATAAGTATTTTCCCGGCCCAAATGCCCATTGAGGGCAGTACCGGGGGCCTCAAAGAGGATTCGATACTTTAAATCCTCATCGTGAGGTACAACAATGCT
AGAGGAATTTGCTACATCTGTGCGATAGCACAAGAGACCATCATCGATGGAATATCGATGTAGGCTGGCCCGCAAGCGTGCCGATAATTGACTGTCCGAG
TCCTTGTAGTCCTCACTCCCAAGGGCATGAAAAAATGCCACAAACTGAGTATCCCGTGGATATGCCACACGAATTAACTCCTCAATATGAGACGGCAAAG
TCGTGACACGATCAAGCTTATAATCGTTTCGGCGAGAGAGGGCATCTGCCAACACATTTTGTTTGCTTGGCTTGTATGCCACCTCGAATTAATATTCTGC
AAAGAAGAAAAGCCAATGAGCTATTCTCTGGAAGAGGTGAGGCAACTGTGTCACCGTGCGTAATGACGCATGATCCGTATAGACGACGAATGGCTTGGAG
CCAAGCAGATGGACTCTTAATTTGATGAGTGCATACTTCATAGTAAGTAGATCTTTGTCATGAGCTGGATAGTTCTTTTTCAGCAGCTTTCAGCTGACGA
GATTCAAATACGATAACTCGATCGCAGCCTGCAGCATCTGTTTTTAACAGGGCGCTGCCTATAGCAAAATCTAATGCATCGCAGACAACACTAAAAGGGT
ACTCAGGAGTTGGCAACGCCAAAATAGGAGCATGGAGGAGACTCTCCTTTACTGTCCAAAATGCGTCAGCATGTGTGTCGTCCCTGCTCCAATCTGTGTC
CTTCTTAAGGAGATCAGTTAATCGCCGAGCCATATCAGCGTAATGCTCACTGTATATTTGTAAGTAATTGGCAAGGCCAAGCCACTTACGCAAGTCTTTT
TGATTTTTAGGAATCAGCCAGTTCACTATAGCCTTGATCTTAGCGGGATCCGGTCTGAGGCCGCGCTTACTAATGAAGCATCCTAGAAAAGGAATCTCTT
CTGCACCAAAAATGCATGAAGACGCGTTGGCGTACAATTTATTAGTGAACATGAACTCAAGCACAGCTCGCAAATGACCAATGTGATTGTCAACATCTGA
CCAACATTGTTTGGCACGACTATGGACCAAAATGTCATCAAAGTACGTTTGTGCGTAATCCCGATGTGGGCGGAAAAGTTGCGTCACCAGACGATCAAAT
GTATCCGGGGCATCACGCAGCCCTTGGGGCATCACCAGCTATTCCCATAGCATACCACTCGGAGTTCTCACTGCTGTAAGCGGAATATCATTCGCTCGCA
TGAGCAATTGATAATATTCATCGACCAAGTCTAGTGCGCTATCCATAGTACAACCGACGTGTTGTTTTGGAGATTATCCTTTCGAGGAATGGGCGTCTGT
GCCGGAATAGTGACCGCATTAAGCTTGTTGTAAACATGTACAATATACCAGTTGCCTTTTGGCTTTTTGACACAAAATGTCGGTGTCGAATGTGGAGATT
TAATCTCACGAACCATTCCTGCCTCGTGCTTAGCACAGAAGAAGTCATCAGTGACATCACATTGATCCTTAGGCAAGGGCCACTGTCGTGTGACACAGTA
TTTCGTCCCAGGAACTAAGTAGATTCCATGACGACACCTCTCTCTATCTGTAGGTAGAACAGAGGGTGGATCGTGGCACACCACATCTTGAAATTCCTTG
ACTAAGGAGTAAAAGGGATCATGGGGGTCTTTCAGTATTGATGACCCACCACGCGCACTGAGTGCTGCTTTTGTGTCCTCCATAACGGCTTCATCCAAAA
GTGAAAAAGAGTTCAACTCTATAATGTCGGGTCGACTGACCACCCCCTCTGAAAGGTCCCCATTCTTTAGTGAGTGATCAAACTCATCGACCGACAACTC
TTCGAGTTCTAAAGGAGCACTTAACGAGGGTATAGCCTTAAGGATAATTGTACCATCACAGGCACCAGTCACTCCGTTAACGAGTGTATACAGATGACAG
TCATCATCACTTTGTGACACAGCACACGATGTGTGATTCGTCTCTCTCTGATCAATATCATAATCGAACGTAATTTTCTCTAAGCTAGAACTGATGTCGT
TATCGACACCCGATGAAAAGTCAGTTGACATGACGTCGTCGTCTTGTGTATTACGTGCCACTTCACGTGCATCCGCTGATCCGGGCTCGGGATGCCTTGG
TATTTCACCAATAACGTCAATATTGACATTCAGCGCGTCGCTATCACAGCCAACATCACTCAGTGGGTACTTACGTGCCACTCCACGCTCATCTGGTGGG
TTCAGCTCCTGATGACTTGACGCTTGGTCAGCAATGCTTTCAGCATTCAGTACGTTGATCTCACAACGACTATCACTTAGCGGAGTACGTGCCGCTTCAC
TATCACATATTGAGCTTTGCTCTATACTCATGTCTTTGACATCGTCAGAATCAACTAACTCTGACATTACGATGTCCAGCACACTGACATTGTCAGTTAG
TGGCTCGCGCCAATAACGCTTCCGATTACGATCAGAGGTGGGTTCATGACCCTCCAAAGCTCTGCTAAGGGCAGTACGCGTGGCGCCTAGTGTTCTCGAC
CTCCAGTTGATCCATGGCTCATGGTGCTCAAGCCAAGCCATAAAAAAAATGAGATCATTTCTCGAGTCCAATCAAGGACTAAACAGCGTCCGATACTATA
AAAACCCGATAAACTTCACACCCAGGAACTTTGAGTGAAGTAACTAGAGTTCCTGTCGCCAAGCGAATAGTGATCGTATCACCCTTGTGCG