Description :
From Genome Similarity Track
Location :
scaffold_32:9344- 11469
Sequence
2125 bases(100 bases per row)
CTTTTCCACTTAGACCAAATCCATTTCGTTGCGATACCAAATGCACCCTGGAATTCACCAAACCATTGACATAAAATGAAGTAAATTATTCTTAATCATG
TACCGCATCATTGAATGGCAACACGATGGGCGGGAGCAACTCGTACCACCGTGGTCTCTCCACGCAAGTGCTCCAGAATCCTTGACAATGCGACTTATGC
GTTCCACCTGACCATCAGTTTTGGAATGGTAAGCAGTAGACATTTCTTGTCTGATGCTGGGCACCTTCAACAAAGCTCGCCAAATCTTCAATGTAAAGCG
CAGTTCTCGATCTGATACAATGCCACCCACAAGCCCTGTGGACCGAACCCTTGATTGAGACTTGTCTGTAACAACCGGTCGCAGTACTGACAATAGCAGC
AAGATAAACCATCTTGCTATAAAGGTCTAAATGTCACAATGCCTGCTTTACCAAACGATTCATCTGAAAGTCAGAGACAAAACGTCATGCGAATGGACTT
CGAGTGCTCTTCCTGAACTGGCAGGCCGGCTAAAAGTGCTGCACACACCAATAATAGCGCGTTTCAATAGGCGCGCACATAATTTATACACTTTAACATG
TTGGAATGCCAATGCACACATAACTCGTTacgttttcttcatcaagaCGACCACTCAAATGGGTATCATGCACCTCGAAAAGTATTCTGTACTTGACGCC
ATTGTTCTGAAGCGTTACTACACGCTGAGTGTCACATACGTTCTCATATAGAAAGTAGTGGAATTAACCACAGCAGTGCAAACATGCAACCGCACGTTTT
CATTAACGACATCTCAGTTCTCAACCTCCTCGAACTCAAAATCTTTAAGCAACGTAAAGCATGTTGCATCTATTCGAATGCTGCACAAATTGTCTCTCAA
ATGTtaacgtcaccatcgtggCATCATGTGATTCATAATGAGGGCGAAGCGAAAGCAGATTTGCCGCCTCACGAAGTCACCATGCTTAACAATGACTTCA
AATTGTATTTCGACAAAAATAATTATCTCGTTATTCTCTGCAAGAGACGTGATACGATATCGCTGTGCtcacgacgcatgatctctatatcgatcacaaa
cggatcagagccaagcagatgcacGTTGAACTTGACTAAGAAATAATTTTTGCAATTAAATCCTTCTCATAAACAGGAAATGCTTCTCTGTTGCTTTACG
ATGACGAGACGCGACTTCGACCTCGCACCATGCTCATAAGCATCtgccgaagcgtcacaaacgacatTGTATGGCCGATCTGAATTTGGAAGAGCCAGAA
TCAAACAGGACAGTCTTGTAGCTCAAATAGCCATATTCTCTGCCGCACCCCGGCATCCTTTGGTAACATTTTTTCGGGAGATGGGTGCGAAGTTGTGTCA
TGTCGGCATATTTTATAAGTACTTGTAGAAATGGTTACCTTGGCAAAGCGACTTCCTCAATTGGTGTTGGGACAAAGACATTGGTTAATAGACAGTGGGC
TTTATCTCTGCAAGATCTACCCACAGGCCCTACTCTTTGATGAAGCAGcccaaatttgaaaatttgtcgCAGCCATGACACGCTTGTATGTTTTGGCGAA
AAACGTTCTGAGATACATTCGAGCGTTGCTCGCAAGTGCTGATGTATTCTCCATATTCGACTTTGCGTGCTCTGTACAAAACTATGAGAGTTGTGTAGCC
GGAATAGGCTTGTACATTGTCCAAACCGCTCCGTCTAGCGTCCCTCCAGCTAATTGAGCGTCTTTTGCACGTTAGAACAGTCCCCGTGAAACAGCCTGCT
ACTCTCGTGGCATcacgctcggagtactcaccatAAAGAGAGGGATGTCGTTATCACTCATCAGCACTCTATTATATCCATCAACGAAGTAATGTGCACC
GAACACAATGCGGCCAGTCATTGACGGGGTTGACTTTGTAGGAATTTTTATGCATTTAACTTATTATAAGCATACACAATTTGCTACTTGCCGTATACCG
TTCTGACACAGAAAGTCGGCGCCGAGTGACGAATTTATTTTCTGATCGAATTTGCTTTGTGCTTCAAAAGGAGGAACTTGCCTATGATGTTACACTGTTT
CCTTGCTAAGCTTCAGTGACGTGTC